ID: 1074110270

View in Genome Browser
Species Human (GRCh38)
Location 10:110417776-110417798
Sequence CCAGACTCCAGCTGCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074110265_1074110270 -6 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG No data
1074110258_1074110270 24 Left 1074110258 10:110417729-110417751 CCATCTCACGGGGCCTCAGTGCA No data
Right 1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG No data
1074110261_1074110270 11 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074110270 Original CRISPR CCAGACTCCAGCTGCAGGGA TGG Intergenic