ID: 1074110274

View in Genome Browser
Species Human (GRCh38)
Location 10:110417783-110417805
Sequence CCAGCTGCAGGGATGGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074110265_1074110274 1 Left 1074110265 10:110417759-110417781 CCTTGTTGGAATAGGGCCCAGAC No data
Right 1074110274 10:110417783-110417805 CCAGCTGCAGGGATGGATTGGGG No data
1074110261_1074110274 18 Left 1074110261 10:110417742-110417764 CCTCAGTGCACAAGGGTCCTTGT No data
Right 1074110274 10:110417783-110417805 CCAGCTGCAGGGATGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074110274 Original CRISPR CCAGCTGCAGGGATGGATTG GGG Intergenic
No off target data available for this crispr