ID: 1074111623

View in Genome Browser
Species Human (GRCh38)
Location 10:110426860-110426882
Sequence GTGGAGAGACGTCATTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074111613_1074111623 27 Left 1074111613 10:110426810-110426832 CCTCTGTCAGGCATGCAACGGGA No data
Right 1074111623 10:110426860-110426882 GTGGAGAGACGTCATTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074111623 Original CRISPR GTGGAGAGACGTCATTGGAA TGG Intergenic
No off target data available for this crispr