ID: 1074118697

View in Genome Browser
Species Human (GRCh38)
Location 10:110477179-110477201
Sequence CATGGTGAAGAGATTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074118697_1074118702 6 Left 1074118697 10:110477179-110477201 CCAACTCTAATCTCTTCACCATG No data
Right 1074118702 10:110477208-110477230 GAGGAAGGCCCTGCATAATCTGG No data
1074118697_1074118700 -9 Left 1074118697 10:110477179-110477201 CCAACTCTAATCTCTTCACCATG No data
Right 1074118700 10:110477193-110477215 TTCACCATGGTCTATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074118697 Original CRISPR CATGGTGAAGAGATTAGAGT TGG (reversed) Intergenic
No off target data available for this crispr