ID: 1074119325

View in Genome Browser
Species Human (GRCh38)
Location 10:110481742-110481764
Sequence ACCCAAAATGTTTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074119320_1074119325 18 Left 1074119320 10:110481701-110481723 CCTTGACTCTCATAGTGCACACT No data
Right 1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG No data
1074119322_1074119325 -6 Left 1074119322 10:110481725-110481747 CCATCCCAGCTGTGACAACCCAA No data
Right 1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG No data
1074119323_1074119325 -10 Left 1074119323 10:110481729-110481751 CCCAGCTGTGACAACCCAAAATG 0: 5
1: 57
2: 280
3: 688
4: 1019
Right 1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG No data
1074119321_1074119325 -5 Left 1074119321 10:110481724-110481746 CCCATCCCAGCTGTGACAACCCA No data
Right 1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074119325 Original CRISPR ACCCAAAATGTTTCCAGACA TGG Intergenic
No off target data available for this crispr