ID: 1074120295

View in Genome Browser
Species Human (GRCh38)
Location 10:110489068-110489090
Sequence CAGTAGAATCAGCATGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074120288_1074120295 29 Left 1074120288 10:110489016-110489038 CCAGGAAGTTAAGCACTAGAACC No data
Right 1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG No data
1074120290_1074120295 8 Left 1074120290 10:110489037-110489059 CCGCCTGCTACTCAATGTGTGGT No data
Right 1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG No data
1074120291_1074120295 5 Left 1074120291 10:110489040-110489062 CCTGCTACTCAATGTGTGGTCTA No data
Right 1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074120295 Original CRISPR CAGTAGAATCAGCATGACCA GGG Intergenic
No off target data available for this crispr