ID: 1074121675

View in Genome Browser
Species Human (GRCh38)
Location 10:110498066-110498088
Sequence GCGCGCCCCGCGGGTGCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074121675_1074121683 -3 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121683 10:110498086-110498108 CGCGGCGCGGGGCCGCTGGCCGG 0: 1
1: 0
2: 5
3: 45
4: 380
1074121675_1074121685 3 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121685 10:110498092-110498114 GCGGGGCCGCTGGCCGGCGGCGG 0: 1
1: 0
2: 14
3: 158
4: 4806
1074121675_1074121688 9 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121688 10:110498098-110498120 CCGCTGGCCGGCGGCGGCGGCGG 0: 1
1: 0
2: 7
3: 166
4: 938
1074121675_1074121686 6 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121675_1074121682 -7 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121675_1074121684 0 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121684 10:110498089-110498111 GGCGCGGGGCCGCTGGCCGGCGG 0: 1
1: 0
2: 4
3: 58
4: 455
1074121675_1074121690 17 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074121675 Original CRISPR GCGCGCCCCGCGGGTGCCCA CGG (reversed) Exonic
900154454 1:1198377-1198399 GCGAGCTCTGTGGGTGCCCACGG - Intergenic
900349623 1:2228386-2228408 GCGCGCCCCCCGCGAGCCCCGGG + Intergenic
900349736 1:2228673-2228695 GCGCGCCCCGGCGGCGCCCGCGG - Exonic
900386486 1:2413195-2413217 GGACGCCCCCCTGGTGCCCACGG + Intronic
903349919 1:22711204-22711226 GCGGGCCCCGCGGGCGCCCGGGG + Intronic
904464935 1:30702033-30702055 GCATGCCCCGTGGGTGTCCAGGG - Intergenic
904701798 1:32362247-32362269 GCGCCCCCCTCGGGTGTCCGGGG - Exonic
905755864 1:40508717-40508739 GAGTGCCCCGCGGCTGCCCACGG - Intergenic
906650295 1:47508203-47508225 GGGCGCCCCGCGGGGCCCGAAGG - Intergenic
907332016 1:53677684-53677706 GTGCTCCTCGCGGGTGCCCGCGG - Intronic
907442874 1:54489421-54489443 GCGCGCAGCGCGGGAGCCCCCGG + Intergenic
1063115584 10:3069144-3069166 GCGCCCCCCGCGGGAGACCCGGG + Intronic
1066465036 10:35642900-35642922 CCGCGCCCCTCGCGCGCCCAAGG - Intergenic
1067263281 10:44713504-44713526 GCACGCACCGTGGGTGCCCGTGG + Intergenic
1070800907 10:79243787-79243809 CCGCGCCCGGAGGGAGCCCAGGG - Intronic
1074121675 10:110498066-110498088 GCGCGCCCCGCGGGTGCCCACGG - Exonic
1076732474 10:132445621-132445643 CCGCACCCCGTGGGTGCCTATGG + Intronic
1077081262 11:725715-725737 GCGCGCCCCGCAGGTGCTGGAGG + Exonic
1077322634 11:1949165-1949187 GTGAGCCCCTCGGGTGGCCATGG + Intronic
1077360961 11:2139885-2139907 GCGCGCCCCGCCCGAGCCCAGGG - Intronic
1078087433 11:8242686-8242708 GCGGGCTTTGCGGGTGCCCAGGG - Intronic
1078345206 11:10541478-10541500 GAGCGCCCCGCTGGCGACCAAGG + Intergenic
1081804990 11:45885623-45885645 GAGCGCCCCGCGCGCGCCCCCGG - Intergenic
1083419585 11:62545624-62545646 GCGCGCACCGCTGGAGCGCAGGG + Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1086959705 11:92969665-92969687 GCGCGCCCTGCGGCTGTCCGGGG + Intergenic
1089610345 11:119665238-119665260 GCGCGCCGGGCCGGTGCCCACGG - Exonic
1090004166 11:122985015-122985037 GCGGGCCCCAGGGCTGCCCAGGG + Intergenic
1202805651 11_KI270721v1_random:4478-4500 GTGAGCCCCTCGGGTGGCCATGG + Intergenic
1091550237 12:1530831-1530853 GCGCGGCCCGCGGGGGCGCAGGG - Intronic
1094682728 12:32679815-32679837 GCGCGTCCCCCAGGTGCCCTTGG - Intronic
1101758688 12:107641718-107641740 TCCCTCCCCTCGGGTGCCCATGG - Intronic
1101807088 12:108073579-108073601 GAGCGTCCTGCAGGTGCCCATGG - Intergenic
1102997532 12:117361484-117361506 GGGCGCCCCGCGCGCGCCCCTGG + Intronic
1103325317 12:120116535-120116557 GCGCGGCCCGCGGGGGCCTCGGG - Intronic
1103521240 12:121537895-121537917 GCGCGGCCCGCGGTTACCCTCGG + Intronic
1103850148 12:123927818-123927840 GCCCGCCTTGCTGGTGCCCAGGG - Exonic
1103981912 12:124742266-124742288 GCACCCCCAGCGGGTGCCCAGGG - Intergenic
1104961268 12:132489730-132489752 GCGCCGCCCGCAGGTGCCCACGG + Exonic
1106246555 13:27954609-27954631 GCGCTCCCAGCGGGCGCCCGGGG - Intergenic
1113311866 13:109140398-109140420 GCGAGGCCCGCGGGCGCCCCGGG + Exonic
1114636333 14:24188885-24188907 GCACGCCCCGCGGGTTGCCAAGG + Exonic
1122418311 14:101560748-101560770 GCGCCCCCCGCCGCTGCCCGAGG - Intergenic
1122558222 14:102592765-102592787 GCGGGCGCGGCGGGAGCCCACGG - Exonic
1125070302 15:35546269-35546291 GCGAGCCCCGCGGCTGCCTGCGG + Intergenic
1129539306 15:76338043-76338065 GCGCGCCCCGGCCCTGCCCAGGG + Intronic
1130283998 15:82540583-82540605 GCGCGCCCCTCCGGTGGGCAGGG + Intronic
1132855825 16:2044168-2044190 GCGGCCCACGCGGGTGCCAAGGG + Intronic
1132991610 16:2798483-2798505 CAGCGCCCCGCGCGCGCCCATGG - Intergenic
1132994772 16:2817267-2817289 CAGCGCCCCGCGCGCGCCCATGG - Exonic
1133259249 16:4537991-4538013 CCGAGCCCCGCGGGTGACCTTGG - Intronic
1146283362 17:31559230-31559252 GCGCGCCCCGCGGCTCCCGGCGG - Intergenic
1146935079 17:36808249-36808271 GCGCCCTCCGCGGGCGCCCTTGG - Intergenic
1147139624 17:38453878-38453900 GCGCGCCGCGCGGGGGCCCGGGG - Intronic
1147170827 17:38617759-38617781 GTGGGCCCTGCAGGTGCCCACGG + Intergenic
1147429624 17:40363417-40363439 GCGCGCGCGGCGGGCGCGCAGGG + Exonic
1148110693 17:45143478-45143500 GCGCGGGCCCCGGGAGCCCAAGG - Exonic
1151673884 17:75588362-75588384 GCGCCCCCCGCGGCCGCCCCTGG - Intergenic
1152711282 17:81871434-81871456 GCGCGGCGCGCGGGTGGCCGGGG + Intergenic
1152924322 17:83080343-83080365 GCGCGCCCCGAGGCCGCCCCGGG + Intronic
1154161233 18:11981851-11981873 GCGCAGCCGGCGGGCGCCCAGGG + Intronic
1155109701 18:22702139-22702161 GCCAGGCCCGCGGGTGCCAAGGG - Intergenic
1160453763 18:78981279-78981301 GCGCGCCCCGCGGGGCCCCCAGG + Intronic
1161267458 19:3370939-3370961 GTGCGCCCAGCGTGTGCTCATGG - Intronic
1167311321 19:48739437-48739459 GCGCGCCCCCCGGGGTCCCAGGG + Exonic
1167645311 19:50702573-50702595 CCGCCTCCCGCGGCTGCCCAGGG + Exonic
926419199 2:12680717-12680739 CCTCTCCCCGCTGGTGCCCAGGG - Intergenic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927596710 2:24403322-24403344 TCGGGCCGCGCGGGAGCCCACGG - Intergenic
929242494 2:39666419-39666441 GCGCAGCCCGCGGCTTCCCAGGG + Intronic
937221680 2:120345937-120345959 GCGCGCCCCTCGGGCCCCCGGGG + Intergenic
937950908 2:127387573-127387595 GCGCGCCCCTCCGGTCCCCGGGG - Intronic
938397803 2:130963805-130963827 GCGCGCCCCGCGCCTGCCAAGGG + Intronic
938817439 2:134918696-134918718 GCGGGCCCCGCGCATGCGCAAGG + Intronic
945032909 2:205682151-205682173 GCGCGCCCTGGGGGTGCCCGGGG + Intronic
946354628 2:219177042-219177064 GCGCGGCGCGCGGGGGCCCTAGG + Intronic
946702182 2:222424722-222424744 GCGCGCGGCGCGGGTCCCCGGGG + Exonic
949018243 2:241725535-241725557 GCGCCCCACGCGGGAGCGCACGG - Exonic
1169145335 20:3248622-3248644 GCGCGGCCAGCGGGGGCCCGGGG + Intergenic
1170226467 20:13996000-13996022 GCGCGAGCTGCAGGTGCCCAGGG - Intronic
1173548183 20:43914910-43914932 GCGCCCACCGCGGGCGCCGAGGG - Exonic
1176016908 20:62938426-62938448 CCGCCCCGCGCCGGTGCCCAGGG + Intronic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1178673790 21:34614552-34614574 GCGCGCCCCGGGGGTGCTAGGGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179994275 21:44966873-44966895 GCCCGCCCTGCAGGTTCCCAGGG + Intronic
1180009951 21:45042945-45042967 GTGCTCCCCGAGGCTGCCCAAGG + Intergenic
1180101833 21:45591016-45591038 TCGCCCGCCGTGGGTGCCCAGGG - Intergenic
1181057832 22:20268255-20268277 GCTCGGGCCGCGGGTGCGCAGGG + Exonic
1181313290 22:21956956-21956978 GAGGGCCCCACAGGTGCCCAGGG + Intergenic
1181346395 22:22223028-22223050 GAGGGCCCCACAGGTGCCCAGGG + Intergenic
1183486384 22:38089460-38089482 CCGCCCCCCGCGGGGGCCCGGGG - Intronic
1183601623 22:38843614-38843636 GCGCTGGCCGCGGGTGCCCCGGG + Exonic
1184034110 22:41910492-41910514 GCGGGCCGCGCGGGGGCCCCGGG + Exonic
1185047566 22:48536739-48536761 GTGCGCGCCGCCTGTGCCCATGG - Intronic
950015091 3:9749731-9749753 GGGCGCCCCGCGGTTCCTCAGGG - Intergenic
954305713 3:49724229-49724251 CCTCGCCCCGAGGGTGACCAGGG + Intergenic
954733480 3:52685622-52685644 GCCCGACCCGCGCGTCCCCACGG + Intronic
961913502 3:130345866-130345888 GCGCGCCTCTCGGGCGCCCGCGG - Exonic
982170339 4:152655634-152655656 GAGCGCCCCGCTGCTGGCCAGGG - Intronic
982460931 4:155667718-155667740 GCGCGCCCCGCGCGTTCTCACGG - Intronic
984888815 4:184473716-184473738 GGGCGCCCCGCGGCGGTCCAGGG - Intronic
985538374 5:476726-476748 GCGCGCCCCTCGCCTTCCCACGG + Intronic
985896094 5:2750918-2750940 GCGCCCCCCGCGCGTCCCCTCGG - Intronic
992400047 5:76403512-76403534 GCGCGCCCCGGGCGGGCCCCCGG + Exonic
992627412 5:78648412-78648434 GGGCGCCCCGCGCGGGCGCATGG - Intronic
994083218 5:95731189-95731211 GCGCTCCCCGCGGAGGCCCCGGG - Exonic
1002401703 5:178994788-178994810 CCGCGCCCCGCGCGTGCACCGGG + Exonic
1002925191 6:1601845-1601867 GCCCGCCACAGGGGTGCCCAGGG - Intergenic
1010021490 6:71165015-71165037 AGGCGCCCCGCCGCTGCCCAAGG - Intergenic
1013793337 6:113859105-113859127 GCGCCCCCTGCCGGTGCCAAAGG + Intronic
1017990234 6:159481255-159481277 GCCCGCACCATGGGTGCCCAGGG + Intergenic
1019144217 6:169966467-169966489 ACGTGCCCCTCGGGTGCACACGG - Intergenic
1019279200 7:191962-191984 GCGCGTCCCGCGGGTGGGCGGGG + Intergenic
1019342946 7:517087-517109 GCGGGCCCCGCGCCTGCCCTCGG - Intronic
1019630549 7:2046697-2046719 GCGCTGCCCGCCTGTGCCCAAGG + Intronic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1020389153 7:7640470-7640492 GTGCGCCCCGCGGGTGTCTATGG + Exonic
1021085892 7:16421028-16421050 GCGCGCCCCGCGGTTCCCTGGGG - Intronic
1025004214 7:55342672-55342694 GGGCGGCCTGCGGGTGACCAAGG + Intergenic
1029422591 7:100478876-100478898 GCGTGCCCCGCCACTGCCCATGG - Exonic
1029570346 7:101364118-101364140 GAGCGTCCCGGGGGTGGCCATGG - Intronic
1033220456 7:139523828-139523850 GCGCGCCCTGCGGGCCCCCCAGG - Intergenic
1033779366 7:144650715-144650737 TCGGGCCACGCAGGTGCCCATGG - Intronic
1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG + Intergenic
1034568219 7:151932822-151932844 GCGCGACCCACGGGTGTCCCTGG - Intergenic
1035169736 7:157010714-157010736 GCGCGCGCAGCGGGGGCCCGGGG + Intergenic
1036032673 8:4991551-4991573 GCGCGCGGCGCAGCTGCCCACGG + Intronic
1037273568 8:17156003-17156025 GCGGCCCCCGCGGGCTCCCAGGG + Intergenic
1040869825 8:52089185-52089207 GAGCGCCCCTCAGCTGCCCAGGG + Intergenic
1049638978 8:143705762-143705784 ACGCGACCAGCGAGTGCCCAGGG - Intronic
1049709311 8:144056526-144056548 GCACTCCCCGCGGGGACCCAAGG + Intronic
1061128205 9:128689733-128689755 GCGCCCCCCGCGCGCGCCCCGGG - Intronic
1061348100 9:130042911-130042933 GCGCGCCCCGCATCTGCCCGCGG + Intronic
1061472174 9:130835345-130835367 GCGCGCCCCCCCGGCGCCCCCGG - Intronic
1198534644 X:137574336-137574358 TCGGCCCGCGCGGGTGCCCAGGG + Intronic