ID: 1074121675

View in Genome Browser
Species Human (GRCh38)
Location 10:110498066-110498088
Sequence GCGCGCCCCGCGGGTGCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074121675_1074121686 6 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121675_1074121683 -3 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121683 10:110498086-110498108 CGCGGCGCGGGGCCGCTGGCCGG 0: 1
1: 0
2: 5
3: 45
4: 380
1074121675_1074121682 -7 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121675_1074121684 0 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121684 10:110498089-110498111 GGCGCGGGGCCGCTGGCCGGCGG 0: 1
1: 0
2: 4
3: 58
4: 455
1074121675_1074121688 9 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121688 10:110498098-110498120 CCGCTGGCCGGCGGCGGCGGCGG 0: 1
1: 0
2: 7
3: 166
4: 938
1074121675_1074121685 3 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121685 10:110498092-110498114 GCGGGGCCGCTGGCCGGCGGCGG 0: 1
1: 0
2: 14
3: 158
4: 4806
1074121675_1074121690 17 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074121675 Original CRISPR GCGCGCCCCGCGGGTGCCCA CGG (reversed) Exonic