ID: 1074121682

View in Genome Browser
Species Human (GRCh38)
Location 10:110498082-110498104
Sequence GGCGCGCGGCGCGGGGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 997
Summary {0: 1, 1: 0, 2: 16, 3: 129, 4: 851}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074121660_1074121682 29 Left 1074121660 10:110498030-110498052 CCTCGCCCGCGGACACCCTGGCC 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121662_1074121682 24 Left 1074121662 10:110498035-110498057 CCCGCGGACACCCTGGCCGTGGA 0: 1
1: 0
2: 1
3: 17
4: 206
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121675_1074121682 -7 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121673_1074121682 -2 Left 1074121673 10:110498061-110498083 CCTGGCCGTGGGCACCCGCGGGG 0: 1
1: 1
2: 2
3: 37
4: 273
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121666_1074121682 13 Left 1074121666 10:110498046-110498068 CCTGGCCGTGGACACCCTGGCCG 0: 1
1: 0
2: 2
3: 12
4: 197
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121663_1074121682 23 Left 1074121663 10:110498036-110498058 CCGCGGACACCCTGGCCGTGGAC 0: 1
1: 1
2: 4
3: 19
4: 113
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121665_1074121682 14 Left 1074121665 10:110498045-110498067 CCCTGGCCGTGGACACCCTGGCC 0: 1
1: 0
2: 4
3: 21
4: 246
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121671_1074121682 -1 Left 1074121671 10:110498060-110498082 CCCTGGCCGTGGGCACCCGCGGG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851
1074121669_1074121682 8 Left 1074121669 10:110498051-110498073 CCGTGGACACCCTGGCCGTGGGC 0: 1
1: 0
2: 2
3: 26
4: 225
Right 1074121682 10:110498082-110498104 GGCGCGCGGCGCGGGGCCGCTGG 0: 1
1: 0
2: 16
3: 129
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074121682 Original CRISPR GGCGCGCGGCGCGGGGCCGC TGG Exonic