ID: 1074121686

View in Genome Browser
Species Human (GRCh38)
Location 10:110498095-110498117
Sequence GGGCCGCTGGCCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1122
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 1036}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074121669_1074121686 21 Left 1074121669 10:110498051-110498073 CCGTGGACACCCTGGCCGTGGGC 0: 1
1: 0
2: 2
3: 26
4: 225
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121675_1074121686 6 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121673_1074121686 11 Left 1074121673 10:110498061-110498083 CCTGGCCGTGGGCACCCGCGGGG 0: 1
1: 1
2: 2
3: 37
4: 273
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121666_1074121686 26 Left 1074121666 10:110498046-110498068 CCTGGCCGTGGACACCCTGGCCG 0: 1
1: 0
2: 2
3: 12
4: 197
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121671_1074121686 12 Left 1074121671 10:110498060-110498082 CCCTGGCCGTGGGCACCCGCGGG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121681_1074121686 -4 Left 1074121681 10:110498076-110498098 CCGCGGGGCGCGCGGCGCGGGGC 0: 1
1: 2
2: 11
3: 83
4: 448
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121679_1074121686 -3 Left 1074121679 10:110498075-110498097 CCCGCGGGGCGCGCGGCGCGGGG 0: 1
1: 1
2: 18
3: 87
4: 569
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036
1074121665_1074121686 27 Left 1074121665 10:110498045-110498067 CCCTGGCCGTGGACACCCTGGCC 0: 1
1: 0
2: 4
3: 21
4: 246
Right 1074121686 10:110498095-110498117 GGGCCGCTGGCCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 80
4: 1036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074121686 Original CRISPR GGGCCGCTGGCCGGCGGCGG CGG Exonic