ID: 1074121690

View in Genome Browser
Species Human (GRCh38)
Location 10:110498106-110498128
Sequence CGGCGGCGGCGGCGGCATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 996
Summary {0: 1, 1: 6, 2: 35, 3: 210, 4: 744}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074121675_1074121690 17 Left 1074121675 10:110498066-110498088 CCGTGGGCACCCGCGGGGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744
1074121671_1074121690 23 Left 1074121671 10:110498060-110498082 CCCTGGCCGTGGGCACCCGCGGG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744
1074121681_1074121690 7 Left 1074121681 10:110498076-110498098 CCGCGGGGCGCGCGGCGCGGGGC 0: 1
1: 2
2: 11
3: 83
4: 448
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744
1074121673_1074121690 22 Left 1074121673 10:110498061-110498083 CCTGGCCGTGGGCACCCGCGGGG 0: 1
1: 1
2: 2
3: 37
4: 273
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744
1074121679_1074121690 8 Left 1074121679 10:110498075-110498097 CCCGCGGGGCGCGCGGCGCGGGG 0: 1
1: 1
2: 18
3: 87
4: 569
Right 1074121690 10:110498106-110498128 CGGCGGCGGCGGCGGCATGAAGG 0: 1
1: 6
2: 35
3: 210
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074121690 Original CRISPR CGGCGGCGGCGGCGGCATGA AGG Exonic