ID: 1074124508

View in Genome Browser
Species Human (GRCh38)
Location 10:110517413-110517435
Sequence GACCAGGGTTTCCCAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074124499_1074124508 19 Left 1074124499 10:110517371-110517393 CCCAACTTGCAATGGACTTCCAG No data
Right 1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG No data
1074124497_1074124508 27 Left 1074124497 10:110517363-110517385 CCAGGATACCCAACTTGCAATGG No data
Right 1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG No data
1074124500_1074124508 18 Left 1074124500 10:110517372-110517394 CCAACTTGCAATGGACTTCCAGG No data
Right 1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG No data
1074124503_1074124508 0 Left 1074124503 10:110517390-110517412 CCAGGGCTATACTCTTTCCCATA No data
Right 1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074124508 Original CRISPR GACCAGGGTTTCCCAACCCC TGG Intergenic
No off target data available for this crispr