ID: 1074125287

View in Genome Browser
Species Human (GRCh38)
Location 10:110524390-110524412
Sequence CTGAGTCAGCAGCTCTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074125287_1074125289 0 Left 1074125287 10:110524390-110524412 CCCTGTTAGAGCTGCTGACTCAG No data
Right 1074125289 10:110524413-110524435 AGATGCTAAGATTTACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074125287 Original CRISPR CTGAGTCAGCAGCTCTAACA GGG (reversed) Intergenic
No off target data available for this crispr