ID: 1074125939

View in Genome Browser
Species Human (GRCh38)
Location 10:110529095-110529117
Sequence CAGCTGTTTGAAAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074125939_1074125942 26 Left 1074125939 10:110529095-110529117 CCTTTTTTCCTTTCAAACAGCTG No data
Right 1074125942 10:110529144-110529166 GTACCCTACCTTGTGGTATATGG No data
1074125939_1074125941 19 Left 1074125939 10:110529095-110529117 CCTTTTTTCCTTTCAAACAGCTG No data
Right 1074125941 10:110529137-110529159 CAGTTGTGTACCCTACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074125939 Original CRISPR CAGCTGTTTGAAAGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr