ID: 1074139700

View in Genome Browser
Species Human (GRCh38)
Location 10:110661168-110661190
Sequence TATCCTAGGTGGGCTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074139700_1074139704 -10 Left 1074139700 10:110661168-110661190 CCTCTCTGAGCCCACCTAGGATA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1074139704 10:110661181-110661203 ACCTAGGATATGAACTATATGGG No data
1074139700_1074139707 -2 Left 1074139700 10:110661168-110661190 CCTCTCTGAGCCCACCTAGGATA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1074139707 10:110661189-110661211 TATGAACTATATGGGCTTCAGGG No data
1074139700_1074139708 18 Left 1074139700 10:110661168-110661190 CCTCTCTGAGCCCACCTAGGATA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1074139708 10:110661209-110661231 GGGTCTGAGTTTTGTGATTCAGG No data
1074139700_1074139706 -3 Left 1074139700 10:110661168-110661190 CCTCTCTGAGCCCACCTAGGATA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1074139706 10:110661188-110661210 ATATGAACTATATGGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074139700 Original CRISPR TATCCTAGGTGGGCTCAGAG AGG (reversed) Intronic
901021252 1:6257092-6257114 CATCCAAGGTGGGCCCAGATGGG + Intronic
903369328 1:22825174-22825196 TAACCTAGAATGGCTCAGAGAGG - Intronic
906708544 1:47912654-47912676 TATGCTGGGAGGGCTTAGAGAGG + Intronic
907137296 1:52151805-52151827 AATCCTGGATGGGCTCAGAGAGG - Intronic
912418863 1:109530149-109530171 TTACCTAGCTGGTCTCAGAGGGG - Intergenic
915595280 1:156893528-156893550 TATTCTGGGTGGGATCACAGAGG - Intergenic
916599990 1:166283349-166283371 GATCCTAGCAGGGCTGAGAGAGG - Intergenic
922177577 1:223208644-223208666 AACCCTGGGTGGGCTCGGAGTGG - Intergenic
924242453 1:242054384-242054406 TAGACCAGGTGGCCTCAGAGTGG + Intergenic
924668088 1:246094363-246094385 TACCCTAGGAGGGCTCTGATAGG + Intronic
1063570681 10:7211946-7211968 CATACAAGGTGGGCTCAGACGGG + Intronic
1069594446 10:69661634-69661656 TGTACAAGGTAGGCTCAGAGAGG + Intergenic
1071562481 10:86655065-86655087 TATCAGGGGCGGGCTCAGAGAGG - Intronic
1072636855 10:97183905-97183927 TATCCTGTGTGGACCCAGAGAGG - Intronic
1074139700 10:110661168-110661190 TATCCTAGGTGGGCTCAGAGAGG - Intronic
1081753461 11:45528417-45528439 TTCCCTAGGTGAGCTCAGAAAGG + Intergenic
1087692196 11:101334306-101334328 TTTATTAGGTGGGCTCAGAGTGG + Intergenic
1087867391 11:103247715-103247737 TATTTTAGTTGGTCTCAGAGTGG + Intronic
1091386338 12:98212-98234 AATCCCAGGTTGGCTCAAAGCGG + Intronic
1101084331 12:101220313-101220335 TATGCTAAGGGGGCTCAAAGAGG - Intergenic
1102966451 12:117131406-117131428 CATCCTCAGTGGGCTGAGAGGGG + Intergenic
1105022722 12:132828241-132828263 TGTCCTAGGTGGGCTCCGCGGGG + Intronic
1106188872 13:27432816-27432838 TAGCCTGGGTGTGCTCCGAGGGG + Intronic
1108168891 13:47721106-47721128 TATCCTAAATGGTCTCACAGAGG - Intergenic
1109479687 13:62933578-62933600 TATCCTAGGTGAATTCAAAGAGG + Intergenic
1112781115 13:102902375-102902397 TTTCCTTGCAGGGCTCAGAGTGG - Intergenic
1114375672 14:22144064-22144086 TACCCAGGGTGGACTCAGAGTGG + Intergenic
1117450048 14:55841208-55841230 TATCTTAGGGAGGCTCAGTGAGG - Intergenic
1118898592 14:69967722-69967744 TTTCATAGATAGGCTCAGAGAGG + Intronic
1118928855 14:70220867-70220889 TATCTCAGGAGAGCTCAGAGTGG + Intergenic
1122087006 14:99314771-99314793 CATGCTAGGTGGGCTTGGAGAGG - Intergenic
1126703253 15:51385839-51385861 TAGCCTAGTTGAGATCAGAGAGG + Intronic
1127857532 15:62964875-62964897 TATCATAGTTGAGCTGAGAGGGG + Intergenic
1129704123 15:77784876-77784898 TCTCTTAGGGAGGCTCAGAGAGG - Intronic
1134235975 16:12466792-12466814 GGTCCTCGGTGGGCTCCGAGGGG + Intronic
1135154675 16:20041999-20042021 TATCCTAGTTGGGAGCATAGTGG + Intronic
1137578435 16:49619261-49619283 AATCCTCGGTGGGCTCTGTGAGG - Intronic
1137786298 16:51140391-51140413 AAACCTAGGTGGGCTCCCAGAGG - Exonic
1140775770 16:78247734-78247756 TATCCAAGGTAGGCACAGTGTGG - Intronic
1141359554 16:83382833-83382855 TACCATGGGTGGGGTCAGAGGGG - Intronic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142135608 16:88450655-88450677 GGTCCTAGGTGGGCTCAGCCTGG + Intergenic
1142947239 17:3440783-3440805 TATCCTAGATGGGGTGTGAGGGG - Intronic
1145358875 17:22193693-22193715 TATCCTAGGTGAATTCAAAGCGG - Intergenic
1146787000 17:35729598-35729620 TATTCTAGGTAGGCTCCCAGAGG - Intronic
1154343384 18:13523165-13523187 TTTCCTGGGTGGGGTCAGATGGG + Intronic
1155850997 18:30773925-30773947 TATCCTAGATGGCCTAAAAGGGG + Intergenic
1157365882 18:47064009-47064031 AAACCTAGGCAGGCTCAGAGGGG + Intronic
1159593152 18:70356676-70356698 TAGGCTGGGTAGGCTCAGAGGGG + Intergenic
1161351926 19:3798125-3798147 TATCCTCGGAGAGCTCATAGAGG - Intronic
1162948016 19:14055140-14055162 CATCCTCCCTGGGCTCAGAGGGG + Exonic
1167945188 19:52982525-52982547 TATTACAGGTGGGCTCAGTGAGG + Intergenic
928983405 2:37157840-37157862 TATCTTAGCTGGGATAAGAGAGG + Intergenic
934621530 2:95812385-95812407 TTTCCTAGGAGGACTCAGAAAGG - Intergenic
934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG + Intronic
937089757 2:119198318-119198340 GATCCTGTGTGGCCTCAGAGAGG - Intergenic
937250434 2:120520235-120520257 TCTCCTTGGTGTGCTCAGAAAGG + Intergenic
937900227 2:127014222-127014244 TTACCTAGGAGGGCTCAGGGAGG + Intergenic
939102234 2:137908220-137908242 TTTTCTAGGTTGGTTCAGAGAGG + Intergenic
939792219 2:146591897-146591919 TATCTTATGTGAGCTCAGTGAGG - Intergenic
944902694 2:204231717-204231739 TATCCTGTGTTGGGTCAGAGTGG + Intergenic
945398085 2:209346213-209346235 TATTCTAGGTGGGCTGAAAGAGG - Intergenic
946217872 2:218199707-218199729 TAGCCAAGGTGGGCTGGGAGTGG + Intergenic
1171439416 20:25148460-25148482 TCTCCCAGGTGGGCTTGGAGGGG - Intergenic
1171992715 20:31708812-31708834 TACCCTAGGTAGGCCCAAAGGGG - Intronic
1174193418 20:48756279-48756301 AATGCTAGGTGGGAACAGAGTGG - Intronic
1174392155 20:50224350-50224372 TGAGCAAGGTGGGCTCAGAGGGG + Intergenic
1183297759 22:37041871-37041893 TGTCCTAGATGGGCTCCCAGAGG + Intergenic
1184945949 22:47804296-47804318 TATCTTAGGGGCCCTCAGAGAGG - Intergenic
1185151026 22:49164066-49164088 TATCCTCGCTGGTCACAGAGTGG - Intergenic
953127252 3:40103175-40103197 TATACTAGGTGGGCACACTGTGG - Intronic
960231852 3:115237770-115237792 TATGGAAGGTGGGCTCTGAGGGG + Intergenic
961321071 3:126076655-126076677 TATCAGAGAGGGGCTCAGAGTGG - Intronic
963395693 3:144730606-144730628 TATCCTAGTTGTCTTCAGAGTGG + Intergenic
963480207 3:145863121-145863143 TATCTTAGGTGGACCCTGAGTGG - Intergenic
968647510 4:1748022-1748044 ACTCCTAGGTGGCCTTAGAGGGG - Intergenic
969626370 4:8307719-8307741 AAGCCTAGATGGGCCCAGAGTGG - Intergenic
970045572 4:11849216-11849238 TAGCCTATGTTGTCTCAGAGAGG - Intergenic
973788662 4:54358453-54358475 CATCCTTGGTGTCCTCAGAGAGG + Intergenic
973830416 4:54753714-54753736 TATGCTAGGTTTTCTCAGAGAGG - Intergenic
976234397 4:82880833-82880855 TATCCAAGGATGGATCAGAGAGG + Exonic
976625227 4:87173140-87173162 TATTATAGGTGGGGTAAGAGTGG - Intronic
979434230 4:120670378-120670400 TTTCCAAGGTGGGATCAGATAGG + Intergenic
983712105 4:170731122-170731144 TTCCCTAGATAGGCTCAGAGAGG - Intergenic
985492630 5:188314-188336 TGTCCTGGGGGGGCTCACAGAGG + Exonic
988809177 5:34767727-34767749 AATCCTAGGTGATTTCAGAGAGG - Intronic
993120939 5:83773682-83773704 TACCCTACGTGGTCTGAGAGGGG + Intergenic
997232195 5:132253308-132253330 TTACCTAGCTGGGCCCAGAGAGG - Intronic
999601800 5:153274676-153274698 CATCCCAGGTCTGCTCAGAGAGG - Intergenic
1001318708 5:170663004-170663026 TCTCCTAGGTGTCCTCAGGGTGG - Intronic
1005105666 6:22221851-22221873 TATTCTAAGTGTGGTCAGAGGGG - Intergenic
1007128825 6:39450337-39450359 TATCCTATAGGAGCTCAGAGAGG + Intronic
1007648113 6:43398350-43398372 AATCCTGGGTGGGCTCGGGGTGG - Intergenic
1011095996 6:83663575-83663597 AATTCTAGGAGGGCTGAGAGAGG + Intronic
1011119104 6:83930934-83930956 AATTCTAGGAGGGCTGAGAGAGG - Intronic
1012263151 6:97111326-97111348 TATCCTAGGCAGGCTCCCAGAGG + Intronic
1013997601 6:116326238-116326260 CATCCTAGAGGAGCTCAGAGGGG + Intronic
1016856350 6:148674294-148674316 GATCCAAGGTGGTCTCTGAGAGG + Intergenic
1018910072 6:168096699-168096721 CTTCCTAGGTGGCATCAGAGCGG + Intergenic
1019823754 7:3266517-3266539 AATCCTAACTGGGCTCAGTGTGG + Intergenic
1021142911 7:17050518-17050540 TTTCATAGTTGGGATCAGAGAGG - Intergenic
1023989076 7:45117427-45117449 TGTCCCAGCTGGACTCAGAGTGG + Intergenic
1024748607 7:52436352-52436374 CATCCACAGTGGGCTCAGAGGGG + Intergenic
1027270940 7:76518395-76518417 GCTCCTCAGTGGGCTCAGAGAGG - Intergenic
1027320701 7:77008226-77008248 GCTCCTCAGTGGGCTCAGAGAGG - Intergenic
1029103312 7:98152634-98152656 TGTGGGAGGTGGGCTCAGAGAGG + Intronic
1031553790 7:123146929-123146951 TTTCCCAGGTCAGCTCAGAGGGG - Intronic
1032094860 7:128932898-128932920 CCTCCCAGGTGGGCTCAGATGGG - Intergenic
1032802055 7:135324832-135324854 TGTCCTAGTTGGACTCAGAAAGG - Intergenic
1036752242 8:11450761-11450783 CAGCCTGGATGGGCTCAGAGAGG + Intronic
1037163741 8:15801721-15801743 TACCCTTGCTGGGCTCAGAGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1047561625 8:125992754-125992776 AACCCTGGGTGGGCTCAGGGTGG - Intergenic
1050021393 9:1287885-1287907 TTTGCTAGGTGGACACAGAGAGG + Intergenic
1056756304 9:89384098-89384120 CCTACTCGGTGGGCTCAGAGAGG + Intronic
1058945693 9:109853922-109853944 CATCCTAGGTGGGCTCTCACTGG + Intronic
1059995503 9:119904930-119904952 TAGCCTATGTGTGCTCTGAGGGG + Intergenic
1060050638 9:120375994-120376016 TCTCCTAGGTGGGCTGGGAGTGG - Intergenic
1187098487 X:16169707-16169729 TAGCCTATGGGGGCTCAGAGTGG + Intronic
1190363037 X:49666959-49666981 AAACCTAGGTGGGCTCCCAGAGG - Intergenic
1193189036 X:78547703-78547725 TAACATTGGTGGCCTCAGAGAGG - Intergenic
1193803343 X:85964381-85964403 TAATTTAGGTGGTCTCAGAGAGG - Intronic
1193803351 X:85964433-85964455 TAATTTAGGTGGTCTCAGAGAGG - Intronic
1196427366 X:115585187-115585209 TATCCTCAAGGGGCTCAGAGTGG - Intronic
1196900464 X:120378070-120378092 TACAGTAGGTGGGGTCAGAGGGG - Intronic
1198752958 X:139953725-139953747 TATCCTATGTGGCCCCAGATGGG + Intergenic