ID: 1074143339

View in Genome Browser
Species Human (GRCh38)
Location 10:110696283-110696305
Sequence GTCCTGGGTAAGAAGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074143339_1074143344 -7 Left 1074143339 10:110696283-110696305 CCCCAGGACTTCTTACCCAGGAC 0: 1
1: 0
2: 1
3: 17
4: 138
Right 1074143344 10:110696299-110696321 CCAGGACTCAGCTAGTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074143339 Original CRISPR GTCCTGGGTAAGAAGTCCTG GGG (reversed) Intronic
900545681 1:3227817-3227839 TTCCTGGGCAAGAGCTCCTGTGG + Intronic
901166895 1:7227843-7227865 GCCCTGGGTGAGGAGTCCTGGGG - Intronic
901673200 1:10867603-10867625 GTCCTGGTCCAGAAGCCCTGGGG - Intergenic
904902124 1:33865620-33865642 GACCTGTGTAAGGAGTCCTGGGG + Intronic
905250099 1:36642924-36642946 CTCCTGGGTAGGAACTCCAGGGG + Intergenic
906644394 1:47463439-47463461 TTCCTGGAGAAGAAGTCATGTGG + Intergenic
906710054 1:47922742-47922764 TTCCAGGGGAAGAAGTGCTGTGG - Intronic
908222573 1:62022711-62022733 GTACTGTGTAAAAACTCCTGGGG + Intronic
908686358 1:66724542-66724564 GTCCTGTGTAAGAAGCACTGAGG - Intronic
910265985 1:85338120-85338142 TTCCCAGCTAAGAAGTCCTGTGG - Intronic
910690112 1:89956948-89956970 GTGCGGGGTAAGAAGTTCTTGGG + Intergenic
912774600 1:112497479-112497501 GCCCTGGGCAGGAAATCCTGAGG + Intronic
912848816 1:113103651-113103673 GTCCTGGGTGAGAGGTCTGGGGG - Intronic
915319729 1:155050106-155050128 TTCCTGGGTAAGGTGGCCTGTGG + Intronic
915584379 1:156836280-156836302 GGGCTGGGTAAAAAGTCCCGGGG + Intronic
916417818 1:164609387-164609409 ATCCTAGGTAAGAACACCTGAGG + Intronic
922953956 1:229583438-229583460 GACTGGGGTCAGAAGTCCTGGGG - Intergenic
1065113065 10:22458902-22458924 GTCCTGTGTAGGAAGGGCTGGGG + Intergenic
1070630751 10:78082700-78082722 GCCCTGGGAAGCAAGTCCTGGGG - Intergenic
1074143339 10:110696283-110696305 GTCCTGGGTAAGAAGTCCTGGGG - Intronic
1078733736 11:14000680-14000702 GTCCATGTGAAGAAGTCCTGAGG - Intronic
1078877472 11:15412809-15412831 CTCCTGTGTCTGAAGTCCTGTGG + Intergenic
1086502441 11:87467181-87467203 GTGCTAGGTCAGAAGTTCTGGGG - Intergenic
1088826160 11:113496178-113496200 GGCCTGGGAAAGAAGCACTGGGG - Intergenic
1089002159 11:115060849-115060871 GTCTTGGATAAAATGTCCTGGGG - Intergenic
1089131598 11:116216458-116216480 GTCCTGGGTACGAAATCCCAGGG - Intergenic
1096321801 12:50620747-50620769 GTTCTGAGTAAGAAAGCCTGTGG + Intronic
1096602045 12:52736246-52736268 GTCCTGGTTCAGAAAACCTGAGG + Intergenic
1096715307 12:53487467-53487489 GTCCTGAGCAGGCAGTCCTGGGG - Intronic
1096867837 12:54575768-54575790 GTCCTGGGTTAGGAGGCCAGGGG + Intronic
1101010017 12:100439560-100439582 GTTCTGGGTAAGATTTGCTGTGG + Intergenic
1102466563 12:113133963-113133985 GCCCTGGGTGAGAGGTCATGAGG - Intronic
1105652682 13:22397187-22397209 GTGCTGGGTTACAAATCCTGAGG - Intergenic
1109093455 13:58079112-58079134 GTACTTGGAAAGAAGTCTTGCGG + Intergenic
1112043434 13:95571468-95571490 GCCTTGGGTAGGAAGTCCTTTGG + Intronic
1112706745 13:102078923-102078945 AATCTGGGTAAGAAGTCCTGTGG + Intronic
1112877453 13:104061955-104061977 GTCTTTGTTAAGAAGTCCTAGGG + Intergenic
1113455143 13:110443428-110443450 GTCCTTGGGCAGAAGTCCTCAGG - Intronic
1113806393 13:113112190-113112212 GTCCTGTGTGAGGTGTCCTGTGG - Intronic
1119936215 14:78594473-78594495 GACCTGGGTAAGTGGTTCTGAGG - Intronic
1122280237 14:100617877-100617899 TTCCTGGGCAAGAACTCCTGGGG + Intergenic
1123161154 14:106278983-106279005 GGGTAGGGTAAGAAGTCCTGGGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123905286 15:24914707-24914729 GTCCTGGGTGAGAGGTCCAGGGG + Intronic
1126257820 15:46648877-46648899 GTCAAGGGTAAGAAATCCAGTGG + Intergenic
1129452553 15:75659092-75659114 GTCCTGGGTACCCAGCCCTGCGG + Exonic
1131359222 15:91774721-91774743 GCTCTGGGTATGAAGTCCAGTGG + Intergenic
1133319651 16:4905050-4905072 GTCCTGGGGATGAATCCCTGAGG + Intronic
1134330899 16:13250320-13250342 GTCCTGAGTGGGCAGTCCTGAGG + Intergenic
1134820655 16:17244238-17244260 GACCTGGGTCAGAATCCCTGGGG + Intronic
1135174984 16:20219972-20219994 GGCATGGATAATAAGTCCTGTGG + Intergenic
1136605177 16:31329108-31329130 GTAATGGGTATGAAGTCCTGGGG - Intronic
1138535127 16:57655894-57655916 GTCCTGGGTGAGAAGGTCTTGGG + Exonic
1139515474 16:67450084-67450106 GTCCTGGGTGTGAAGACCTGAGG - Intronic
1140096489 16:71880332-71880354 ATCCAGGGTTAGAAGTACTGTGG + Intronic
1140155162 16:72417471-72417493 GTCCTGGTTAACAAGATCTGGGG - Intergenic
1144461824 17:15464523-15464545 GAGCTGGGTAACAAGTCCTGGGG + Intronic
1145872426 17:28285954-28285976 GACTTCGGAAAGAAGTCCTGAGG - Intergenic
1147613889 17:41817197-41817219 GGCCTGGGTGAGAAGGGCTGGGG + Exonic
1147899437 17:43774364-43774386 GTGCATGGCAAGAAGTCCTGAGG - Intronic
1147989274 17:44323387-44323409 GTCCTGGGGGAGGAGTCCTAGGG - Intronic
1157200399 18:45654442-45654464 AGCCCAGGTAAGAAGTCCTGGGG + Intronic
1157451630 18:47793684-47793706 GCCCTGGGTAAGAAATTCAGTGG + Intergenic
1157689725 18:49671394-49671416 GCACTGGGCAAGAAGTCCAGTGG - Intergenic
1162838764 19:13340278-13340300 GTGCTGGGTAGCATGTCCTGTGG - Intronic
925285719 2:2714361-2714383 GTCTTGGGGAAGGGGTCCTGGGG + Intergenic
925670511 2:6305128-6305150 GTCCTGGGCAGGAATCCCTGCGG - Intergenic
926725449 2:15993961-15993983 GACCTGGAGAAGAAGTCCTTGGG - Intergenic
932895478 2:75635486-75635508 GTCCTGGGTAAAGAGGGCTGAGG - Intergenic
934048782 2:88192743-88192765 GCCCTGGGAAAGGAGCCCTGGGG + Intergenic
935812427 2:106811897-106811919 GTACAGGGTAAAAAGTCCAGGGG + Intronic
937131825 2:119519514-119519536 GTGCTGGTTAAGAAGCTCTGCGG + Intronic
937874065 2:126807492-126807514 GTTCTGGGTGAGAACTGCTGTGG - Intergenic
939278850 2:140037066-140037088 GTACTGGGTAAGAAGACCTGTGG - Intergenic
942786868 2:179710319-179710341 CTCCTGGGTAGGTAGTCCTGTGG - Intronic
943209306 2:184942365-184942387 ATCCAGGTTAAGATGTCCTGTGG - Intergenic
1170449487 20:16467338-16467360 GTACTGGGTAAGAGGAGCTGTGG - Intronic
1170751284 20:19147978-19148000 GTCCTGGGTAAAAGGAGCTGAGG - Intergenic
1172814794 20:37677879-37677901 GCCCTGGGAAACAAGTCCAGAGG + Intergenic
1173602584 20:44306664-44306686 GCTCTGGGGAGGAAGTCCTGGGG + Exonic
1173819544 20:46011568-46011590 GTCCTGGGTGTAGAGTCCTGGGG - Exonic
1174092102 20:48057682-48057704 GTCCTTGGTCAAAGGTCCTGAGG + Intergenic
1175229458 20:57464470-57464492 GTCCTGGGAACTAAGTCCCGGGG + Intergenic
1175479214 20:59299981-59300003 ATCCTGGGTTAGCGGTCCTGTGG - Intergenic
1175537213 20:59722924-59722946 GTGCTGGGAAAGACGCCCTGTGG + Intronic
1176235432 20:64051467-64051489 GGCCTGGGAAAGAGGTCCTCGGG + Intronic
1177369159 21:20179675-20179697 GCCCTGGGCAGCAAGTCCTGAGG + Intergenic
1179979996 21:44890890-44890912 GTCCTGGGTGTGCAGCCCTGGGG - Intronic
1180924460 22:19544243-19544265 GACCTGGGTGCCAAGTCCTGAGG - Intergenic
1181479361 22:23188416-23188438 TTCCTTGGTTGGAAGTCCTGTGG + Intronic
1183139452 22:35922966-35922988 GTGCTGGGTTTGAAGTCCTATGG + Intronic
1185318353 22:50188788-50188810 GTCCTGGGACAGAAGCCCTGCGG + Intronic
951604836 3:24421595-24421617 GTCCTGGGTGGCACGTCCTGTGG - Intronic
952778645 3:37071638-37071660 GGCCTGGATATGAAATCCTGTGG - Intronic
959753390 3:109865553-109865575 GTACTGGCTAAGAAGTACTGTGG - Intergenic
960963085 3:123085516-123085538 GCCCTGGGTTAGATGACCTGCGG + Intronic
962248290 3:133816805-133816827 CTTCTGTGTAAGAAGTCTTGGGG + Intronic
962380530 3:134894903-134894925 TTCCTGGGAATGAAGTACTGTGG + Intronic
966079072 3:175977798-175977820 TTCCTGGGCATGAAATCCTGTGG - Intergenic
966515985 3:180821287-180821309 TTCCTGGGCATGAAATCCTGTGG + Intronic
968460331 4:721583-721605 GTCCTGTGAAAGGAGTCCTGGGG - Intronic
969465895 4:7356161-7356183 GTCCTGGGTGAGTGGCCCTGAGG - Intronic
969821879 4:9727028-9727050 GTCCTGGGGATTAAGGCCTGTGG + Intergenic
970513347 4:16802421-16802443 TTCCTGGGGAAGAACTCCTATGG + Intronic
970998958 4:22301075-22301097 GGACTGGGTAAGATGTCCTTAGG - Intergenic
971929662 4:33064019-33064041 GTCCCAGCTAAGAAGTCTTGTGG - Intergenic
973543880 4:51960882-51960904 GAATTGGGTAAGAATTCCTGGGG - Intergenic
978605686 4:110476614-110476636 GTCCTGGGCAGGAGGACCTGAGG - Exonic
979025881 4:115574256-115574278 TTCCTGGGTAAGAAGACTGGGGG + Intergenic
985035867 4:185839376-185839398 GTCCTGGGTAAAATAGCCTGAGG - Intronic
986481127 5:8189382-8189404 GTACTGGCTCAGAAGTGCTGTGG - Intergenic
986965745 5:13268379-13268401 GTTCTGGCTAAGAAGTTGTGAGG + Intergenic
987835717 5:23158454-23158476 TTCCTTGATAAGAAATCCTGAGG - Intergenic
989360877 5:40599906-40599928 GACCTGGTTCAGATGTCCTGGGG - Intergenic
989719254 5:44504834-44504856 GCCCTGGGTAATAAGCCCTGAGG - Intergenic
991034865 5:62119047-62119069 GTGCTGGGTATGAAGACATGGGG + Intergenic
991604642 5:68388585-68388607 GTCCTGGGAAAGCATCCCTGGGG + Intergenic
992543354 5:77785677-77785699 TTCCTGGGCATGGAGTCCTGTGG + Intronic
992743366 5:79795714-79795736 GTCTGGGGCAAGGAGTCCTGAGG + Intronic
993563150 5:89437603-89437625 TGCCTGGGTAAGCAGTCATGAGG - Intergenic
999228150 5:150044563-150044585 CTCCTGAGTCAGAAATCCTGTGG - Intronic
999350535 5:150866210-150866232 ATCCTGGCTAGGAATTCCTGTGG + Intronic
999615275 5:153416567-153416589 CCCATGGGTAAGAAGACCTGGGG + Intergenic
999701650 5:154233846-154233868 GTCGTGGGTTAGAATTGCTGTGG + Intronic
1000148869 5:158480476-158480498 GTCCTGGGTGAGAAAGGCTGAGG - Intergenic
1000913939 5:167057424-167057446 GTACTGGGTAAAAACACCTGTGG + Intergenic
1001127335 5:169031613-169031635 GTCCTGGTTGAGAAATCCAGAGG + Intronic
1004596728 6:17106046-17106068 GGCCTGGGGAACAAGTCCTAAGG - Intronic
1005294693 6:24413645-24413667 TTCCGGGTTAAGAAGTCCTTGGG - Intronic
1010042176 6:71397789-71397811 GTCCTGAGACAGAAGTCATGAGG - Intergenic
1012602804 6:101118787-101118809 GTTTTGGGGAAGAAGTTCTGAGG - Intergenic
1019612495 7:1944053-1944075 TTCCTGGGAAGGGAGTCCTGTGG - Intronic
1019710684 7:2516953-2516975 GTCCTGGGGAAGAGGGGCTGGGG - Intronic
1020316874 7:6911763-6911785 GTCCTGGGGATTAAGGCCTGTGG - Intergenic
1022783836 7:33615158-33615180 GTACTGGGTAAAAAGAACTGTGG - Intergenic
1023660727 7:42468685-42468707 GTCCTGGGAGAGCAGTGCTGTGG + Intergenic
1023879965 7:44312726-44312748 GTCCTGGGTTGGATGTCATGTGG + Intronic
1026437606 7:70413406-70413428 GACCTGGGTGAAAAGTCCTGGGG + Intronic
1029172573 7:98641438-98641460 GTCCTGGACATGATGTCCTGGGG + Intergenic
1031101865 7:117490989-117491011 GTTCTGGGTAATATGTCCTTAGG + Intronic
1031865310 7:127032325-127032347 GTCCTGGAGCAGGAGTCCTGAGG - Intronic
1033522084 7:142170861-142170883 CTCTTTGGTAAGAAGTCCTTTGG + Intronic
1039733971 8:40310000-40310022 GTCCTGAGTAAGAAGCCTGGGGG - Intergenic
1043149752 8:76700273-76700295 GTGCTGGGAAAGAAGACCAGTGG - Intronic
1048453756 8:134558257-134558279 TTCCTGGGGAGGAAGTGCTGGGG - Intronic
1049539429 8:143201058-143201080 GTCCTGGGAAAGTGGTCCTGAGG - Intergenic
1054805868 9:69395568-69395590 GTCCTGTGTGATAGGTCCTGGGG + Intergenic
1057273332 9:93663141-93663163 GTCCTGAGTAGGTAGTGCTGTGG + Intronic
1058438487 9:104986077-104986099 TTCCTGGCTGAGATGTCCTGAGG - Intergenic
1058828835 9:108797564-108797586 GGCCTGGGTTAGAACTCCCGGGG - Intergenic
1062221894 9:135420789-135420811 GTGCTGGGTAATTTGTCCTGGGG + Intergenic
1189943724 X:46155184-46155206 GTCCTGCTTAAGAAGTCTTGGGG + Intergenic
1191636125 X:63379232-63379254 GTCTTGGGTGAGAAGTCTGGGGG - Intergenic
1192467471 X:71367422-71367444 GACCAGGGAAATAAGTCCTGTGG + Intronic
1193754076 X:85384974-85384996 CTACTGTGTAAGAAATCCTGGGG + Intergenic
1198237268 X:134747124-134747146 GTCCTGAATGAGAAGGCCTGAGG - Intronic
1200311792 X:155085876-155085898 GTCATGGCAAAGCAGTCCTGGGG - Intronic