ID: 1074145088

View in Genome Browser
Species Human (GRCh38)
Location 10:110710559-110710581
Sequence CGCCTCAGTCCTTCCTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074145088_1074145096 28 Left 1074145088 10:110710559-110710581 CCCCAGTAGGAAGGACTGAGGCG 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1074145096 10:110710610-110710632 CAGTTTTCTTGGAGAGAAGCTGG No data
1074145088_1074145094 -1 Left 1074145088 10:110710559-110710581 CCCCAGTAGGAAGGACTGAGGCG 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1074145094 10:110710581-110710603 GGGAGAAGGAGCTCACAGTTTGG No data
1074145088_1074145095 17 Left 1074145088 10:110710559-110710581 CCCCAGTAGGAAGGACTGAGGCG 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1074145095 10:110710599-110710621 TTTGGAGAATGCAGTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074145088 Original CRISPR CGCCTCAGTCCTTCCTACTG GGG (reversed) Intronic
902388800 1:16090984-16091006 AACCTGAGTCCTTCCTACTTTGG + Intergenic
903736854 1:25535366-25535388 AGCCTCTGTTCTTCCTTCTGCGG + Intergenic
906776242 1:48532117-48532139 CTCCTCATTCCTTTCTAATGGGG + Intergenic
908009956 1:59765800-59765822 AGCCTCAGTCTTTCCCTCTGTGG + Intronic
911766067 1:101676490-101676512 CTCCTTAGTCCTTCTTTCTGAGG + Intergenic
913045723 1:115072227-115072249 CTCCTCACCCCTTCCTACAGAGG + Intronic
916491461 1:165305960-165305982 CTCCTTGGTCCTTCCTCCTGTGG - Intronic
918564590 1:185913435-185913457 CTTCTAATTCCTTCCTACTGTGG - Intronic
919505608 1:198394361-198394383 TGCCTCAGTGCTTCCTCATGTGG - Intergenic
920673945 1:208025904-208025926 TGCCACAGTCATTTCTACTGAGG + Exonic
922152519 1:223018015-223018037 CATCTCACCCCTTCCTACTGTGG - Intergenic
922607196 1:226897027-226897049 CTCCTCTGTCCTTCCTTCTTAGG - Intergenic
924781070 1:247148117-247148139 CTCCTCATTCTTTCCTACTTTGG + Intronic
1065982282 10:30911856-30911878 GGCTCCAGTCCTTCCTACTCTGG + Intronic
1070592011 10:77808075-77808097 AGACTCAGTCCTTCCTGCAGAGG - Intronic
1073137764 10:101229164-101229186 CGCCTCGGCTCTTCCAACTGCGG - Exonic
1074145088 10:110710559-110710581 CGCCTCAGTCCTTCCTACTGGGG - Intronic
1076943674 10:133627732-133627754 TGCCTCATCCCTTCCTACTGCGG + Intergenic
1078087651 11:8243788-8243810 CTCCAAAGGCCTTCCTACTGTGG - Intronic
1078931196 11:15913100-15913122 CACCGCAGTCCTGCCTGCTGGGG - Intergenic
1079381167 11:19938777-19938799 CTCCTTTGTTCTTCCTACTGAGG - Intronic
1081870980 11:46382355-46382377 CGCCGCAATCCTTGCTGCTGGGG - Exonic
1088168229 11:106964366-106964388 GGCCTCTGGCCTTCCTGCTGTGG + Intronic
1106170289 13:27282881-27282903 GGCCTCACTCCTGCCTTCTGTGG - Intergenic
1106698015 13:32199147-32199169 AACCTCAGTCATTCCCACTGGGG + Intronic
1108364210 13:49693712-49693734 CTCCTCAGTCCTTTCTACTCTGG + Intergenic
1109215792 13:59588348-59588370 CAACTCAGTCTTTCCTACTCAGG + Intergenic
1111859650 13:93685839-93685861 CTCTTCAATCTTTCCTACTGGGG - Intronic
1112439987 13:99418209-99418231 TGCCTCAGCTCTTCCTTCTGGGG - Intergenic
1113467430 13:110522165-110522187 TGCCTCAGTGCTTCCTCCTGGGG + Intergenic
1113836770 13:113333142-113333164 CGCCTCAGGCTTTCCTGATGAGG - Intronic
1116875405 14:50106701-50106723 TTCCTCAGGCCTTCCTCCTGCGG + Intergenic
1118310254 14:64686908-64686930 CGCCTCTGTCCTAGCTACTCGGG + Intergenic
1119344642 14:73913186-73913208 TGCCTCAGTCCCAGCTACTGGGG - Intronic
1121788588 14:96681692-96681714 TGCCTCACTCCTGCCTGCTGGGG - Intergenic
1123699318 15:22902840-22902862 CGGCCCAGTCCTGCCTGCTGTGG - Intronic
1124135338 15:27030355-27030377 TGCCTCAGCCATTCCTTCTGTGG + Intronic
1130407173 15:83612455-83612477 CCCCTCAGCACTTCCTGCTGGGG + Intronic
1133928585 16:10213761-10213783 TCCCTCACTCCTGCCTACTGGGG + Intergenic
1135380711 16:21994069-21994091 CGCCTGAGTCCCAGCTACTGAGG + Intronic
1135757591 16:25111093-25111115 CGCCTTAGTCCTGGCTACTCAGG - Intergenic
1136152237 16:28358575-28358597 CGCCTTAGTCCCACCTACTTGGG + Intronic
1136210843 16:28756707-28756729 CGCCTTAGTCCCACCTACTTGGG - Intronic
1136255564 16:29036666-29036688 CGCCTTAGTCCCACCTACTTGGG - Intergenic
1136309752 16:29399571-29399593 CGCCTTAGTCCCACCTACTTGGG + Intronic
1140077040 16:71709751-71709773 GGCCTCAGTGATTCCTAATGGGG + Intronic
1140365239 16:74375970-74375992 CGCCTTAGTCCCACCTACTTGGG - Intergenic
1140454712 16:75098329-75098351 CGCTTCATACTTTCCTACTGAGG - Intronic
1140496618 16:75394786-75394808 CACCTCTGTCCTAGCTACTGTGG - Intronic
1143830882 17:9649525-9649547 TGCCTCCCTCCTTCCTTCTGCGG + Intronic
1147034915 17:37672638-37672660 CTCCTCGTTCCTTCCTCCTGAGG - Intergenic
1147587543 17:41661007-41661029 GGACTCTGTCCTTCCGACTGTGG - Intergenic
1147948019 17:44091520-44091542 AGCCTCAGTCCTGCCAACTTTGG + Intronic
1153940773 18:9974529-9974551 GGCCTCATTCCTTCCCACTGGGG - Intergenic
1157599822 18:48887059-48887081 CTCCTCACTCCTTCCCTCTGAGG - Intergenic
1162409861 19:10499231-10499253 CGCCTCAGCCCCTCAAACTGTGG + Intronic
1163566959 19:18057680-18057702 AGCCTCTTTCCTTCCTACCGTGG - Intergenic
1164078510 19:21842667-21842689 TGCCTCAGTCTTGCCCACTGGGG - Intronic
1164243155 19:23407931-23407953 TGCCTCGGTCCTGCCTACAGCGG - Intergenic
1165956599 19:39505148-39505170 CTCCTCAGTCCTAACCACTGGGG - Intronic
1166753029 19:45173776-45173798 CCCCTCACTCCTTCCTCCTGGGG - Intronic
1168490450 19:56804356-56804378 TGCCTCAGTCAATCCAACTGAGG + Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
926196451 2:10766244-10766266 TCCCTCAGTCCTTCCTACACCGG + Intronic
927110648 2:19861625-19861647 CATCTTGGTCCTTCCTACTGAGG + Intergenic
927210220 2:20634555-20634577 GGCCTCAGTCCCACCTCCTGAGG - Intronic
927428460 2:23006825-23006847 GGCCTCAGTTGTTCCTCCTGTGG + Intergenic
928171956 2:29009907-29009929 GGCCTCAGTCCTTTCTGCTGTGG + Intronic
931131002 2:59335718-59335740 CGCCTCAGTTCTTCCAACATGGG - Intergenic
932594498 2:73085817-73085839 CGCCGCTGTTCTTCCTAGTGAGG + Intronic
932898179 2:75665274-75665296 CGCCTGAGTCCCAGCTACTGAGG - Intronic
933597567 2:84297394-84297416 CACCACATTCCTTACTACTGGGG - Intergenic
936146035 2:109981170-109981192 AGCCTCAGGTCCTCCTACTGTGG - Intergenic
936198654 2:110390308-110390330 AGCCTCAGGTCCTCCTACTGTGG + Intergenic
941744189 2:169068897-169068919 GGCCTCAGTACTTTCCACTGTGG + Intronic
942615136 2:177783974-177783996 GGACTCAGTCCTTCCTGCAGTGG - Intronic
942902848 2:181144194-181144216 TGCCACAGTGCCTCCTACTGTGG + Intergenic
946497211 2:220206497-220206519 GGCCTCAGTCCTTCCTAGGCTGG - Intergenic
1168779557 20:477321-477343 CGCCTGTGTCCTAGCTACTGGGG - Intronic
1171781030 20:29417891-29417913 TGCCTCATCCCTTCCTACTGCGG + Intergenic
1172667869 20:36613382-36613404 GGCCACAGTCCTACCTTCTGAGG + Exonic
1175438040 20:58968378-58968400 TGACTCTGTCCTTCCTGCTGAGG - Intergenic
1176194152 20:63829595-63829617 CTCCTCAGTCCTTTCTGCAGTGG + Intronic
1176207729 20:63898977-63898999 CGCCATAGGCCTTCCCACTGTGG + Intronic
1176213097 20:63934956-63934978 TGACTCAGTGCATCCTACTGTGG + Exonic
1183994905 22:41625626-41625648 GTCCTCTGTCCTTCCTACTAAGG - Intronic
952494030 3:33900583-33900605 CTCCTGAGTCCTGCCTCCTGGGG + Intergenic
953330966 3:42052810-42052832 CACCTCAGTCCTTAACACTGTGG - Intronic
953875348 3:46663508-46663530 CCCCTCTGTCCTACCTCCTGAGG + Intergenic
957083965 3:75663394-75663416 TGCCTCATCCCTTCCTACTGCGG - Intergenic
960148672 3:114230441-114230463 AGCCTCAGTCCTGACTCCTGGGG - Intergenic
961490806 3:127255738-127255760 GGCCTCAGGCCCACCTACTGGGG + Intergenic
962448665 3:135492830-135492852 CCACTCTGGCCTTCCTACTGCGG + Intergenic
965506685 3:169523260-169523282 TGCCTCTGTCCTCCCTTCTGGGG + Intronic
968356157 3:198109154-198109176 TGCCTCATCCCTTCCTACTGCGG - Intergenic
975722428 4:77261318-77261340 TCCCTGAGTCCTTCCTACTGAGG - Intronic
976278363 4:83301582-83301604 CCCCTCGCTACTTCCTACTGGGG + Intronic
980011986 4:127606564-127606586 TGCCTCATTCTCTCCTACTGAGG - Intergenic
984586680 4:181572267-181572289 ATTCTCAGTCCTTCCTACAGGGG + Intergenic
985447029 4:190028194-190028216 TGCCTCATCCCTTCCTACTGCGG + Intergenic
986173667 5:5333909-5333931 GGCATCAGTCCTTCCTTCTCAGG + Intergenic
987633450 5:20507036-20507058 TGGCTCAGTCTTTCCTAATGTGG - Intronic
987707959 5:21479240-21479262 CGCCTTAGTCCCAGCTACTGAGG - Intergenic
988751822 5:34195713-34195735 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991737150 5:69638488-69638510 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991739587 5:69656521-69656543 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991757915 5:69896658-69896680 CGCCTTAGTCCCAGCTACTGAGG - Intergenic
991788725 5:70218212-70218234 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991791162 5:70236262-70236284 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991813475 5:70493317-70493339 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991816607 5:70514598-70514620 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991819047 5:70532639-70532661 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991837318 5:70772540-70772562 CGCCTTAGTCCCAGCTACTGAGG - Intergenic
991881171 5:71218576-71218598 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
991883608 5:71236597-71236619 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
993595129 5:89844726-89844748 TGCCTCATTGCTTCCTGCTGAGG - Intergenic
994420026 5:99520204-99520226 CGCCTTAGTCCCAACTACTGAGG - Intergenic
994487183 5:100394935-100394957 CGCCTTAGTCCCAACTACTGAGG + Intergenic
998152461 5:139765113-139765135 CCACTCAGTACTTCCCACTGCGG + Intergenic
998381763 5:141730751-141730773 GGCCTGGGTCCTTCCTACTGTGG - Intergenic
998805996 5:145918474-145918496 ACTCTCAGTCCTTCCTTCTGTGG - Intergenic
999326550 5:150647837-150647859 CGCCTCGGCCCTTCCTACACAGG - Intronic
1004107759 6:12681687-12681709 CTCTTGAGACCTTCCTACTGTGG - Intergenic
1006683719 6:35815072-35815094 CGCCTCAGTGCCTCCTTCTAGGG - Intronic
1008667830 6:53733886-53733908 CATCTCACTCCTTCCTTCTGAGG + Intergenic
1009020246 6:57941302-57941324 CGCCTTAGTCCCAGCTACTGAGG + Intergenic
1009735880 6:67675286-67675308 TGACTCAGTCCATCCTAGTGTGG + Intergenic
1013357619 6:109360424-109360446 AGCCTCTGTCCCTGCTACTGTGG - Intergenic
1015012720 6:128371582-128371604 AGCCTCCTTCCTTCCAACTGTGG + Intronic
1023166866 7:37351477-37351499 TGCCTCATTCTTTCCTATTGTGG - Intronic
1024584269 7:50827470-50827492 TGCATCAGTCCTTCCTCCTGTGG - Intergenic
1025156538 7:56612164-56612186 TGCCTGAGCCCTGCCTACTGGGG - Intergenic
1025157086 7:56616792-56616814 TTCCTGAGTCCTGCCTACTGGGG - Intergenic
1025759625 7:64377853-64377875 TGCCTGAGTCCTGCCTGCTGGGG + Intergenic
1025785859 7:64642795-64642817 TGCCTCAGTCCTGCTTAATGGGG + Intergenic
1027053074 7:75031901-75031923 GGCCTCAGTCCTTCCCCATGTGG + Intronic
1029314091 7:99695646-99695668 AACCTCAGACCTTCCTCCTGAGG + Intronic
1030614510 7:111724722-111724744 CGCCTGAGTCCTAGCTACTCAGG - Intergenic
1032010349 7:128342885-128342907 CACCTCAGTCCGTCCTTCTCTGG + Intronic
1032084116 7:128874639-128874661 CGCCTGTCTCCTTCCTTCTGAGG + Intronic
1032471962 7:132185140-132185162 CAAATCAGACCTTCCTACTGTGG - Intronic
1034901317 7:154909674-154909696 CTCCTCCGTCCTCCCTGCTGTGG - Intergenic
1035648364 8:1245910-1245932 CGCCTCTGTCCTCCCCACGGCGG - Intergenic
1038011508 8:23480193-23480215 TGGCTCAGTGCATCCTACTGTGG - Intergenic
1040371485 8:46780144-46780166 TGCCTGAGCCCTGCCTACTGGGG + Intergenic
1040374826 8:46814900-46814922 TGCCAGAGTCCTGCCTACTGGGG + Intergenic
1040377741 8:46842795-46842817 TGCCTGAGTTCTGCCTACTGGGG + Intergenic
1040378679 8:46851187-46851209 TGCCTGAGCCCTGCCTACTGGGG + Intergenic
1044684299 8:94812389-94812411 TGCAGCATTCCTTCCTACTGGGG + Intergenic
1045751475 8:105489155-105489177 GGCCTCTGTTCTCCCTACTGTGG - Intronic
1049336706 8:142090350-142090372 TGACCCAGTCCTTCCTACCGAGG - Intergenic
1053071402 9:35104259-35104281 AGCCTCAGTCCTAACTCCTGGGG - Exonic
1055309237 9:74961360-74961382 TGCCTTTGTCCTTCCTTCTGAGG - Intergenic
1056703041 9:88926445-88926467 TGCCTCAGTCCTGTCTCCTGGGG + Intergenic
1059071175 9:111137861-111137883 TGCTTCAGTCCTTTCTATTGTGG - Intergenic
1060506460 9:124201668-124201690 CTCTTCACTCCCTCCTACTGAGG + Intergenic
1060976826 9:127770048-127770070 CTCCTCAATCCATCCTACAGAGG - Intronic
1061360247 9:130137072-130137094 CTCCTCAGTCCTTCCCTCAGAGG + Exonic
1061671536 9:132191273-132191295 AGCCTCATCCCTTCCTCCTGTGG + Intronic
1185567966 X:1110092-1110114 CCCCTCGGTCCTGCCTCCTGGGG - Intergenic
1186834950 X:13428591-13428613 CCCCTCAGACCTTCCCATTGTGG + Intergenic
1188107111 X:26159228-26159250 CAGCTCAGTACTTCCTACTCAGG + Intergenic
1200845304 Y:7826387-7826409 TGCCTGAGTCCTGCCTACTGGGG - Intergenic
1202244705 Y:22808223-22808245 TCCCTGAGTCCTGCCTACTGAGG + Intergenic
1202260378 Y:22964133-22964155 TGCCTGAGCCCTGCCTACTGGGG + Intergenic
1202267637 Y:23037506-23037528 TGCCTGAGTCCTGCCTACTGGGG + Intergenic
1202270860 Y:23072854-23072876 TGCCTGAGTCCTGCCTAATGGGG + Intergenic
1202295166 Y:23347828-23347850 TGCCTGAGTCCTGCCTAATGGGG - Intergenic
1202397694 Y:24441969-24441991 TCCCTGAGTCCTGCCTACTGAGG + Intergenic
1202413365 Y:24597874-24597896 TGCCTGAGCCCTGCCTACTGGGG + Intergenic
1202420629 Y:24671250-24671272 TGCCTGAGTCCTGCCTACTGGGG + Intergenic
1202423855 Y:24706598-24706620 TGCCTGAGTCCTGCCTAATGGGG + Intergenic
1202446934 Y:24963487-24963509 TGCCTGAGTCCTGCCTAATGGGG - Intergenic
1202450157 Y:24998832-24998854 TGCCTGAGTCCTGCCTACTGGGG - Intergenic
1202457417 Y:25072194-25072216 TGCCTGAGCCCTGCCTACTGGGG - Intergenic
1202473087 Y:25228118-25228140 TCCCTGAGTCCTGCCTACTGAGG - Intergenic