ID: 1074146408

View in Genome Browser
Species Human (GRCh38)
Location 10:110720864-110720886
Sequence AAAAGCCAGAGGTCCCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074146405_1074146408 -7 Left 1074146405 10:110720848-110720870 CCCACATTATCAGAATAAAAGCC 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146399_1074146408 20 Left 1074146399 10:110720821-110720843 CCTCTACTCAAAACCCTCCAGAC 0: 1
1: 0
2: 10
3: 59
4: 357
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146400_1074146408 7 Left 1074146400 10:110720834-110720856 CCCTCCAGACCCTTCCCACATTA 0: 1
1: 0
2: 3
3: 19
4: 264
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146404_1074146408 -3 Left 1074146404 10:110720844-110720866 CCTTCCCACATTATCAGAATAAA 0: 1
1: 0
2: 2
3: 28
4: 672
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146402_1074146408 3 Left 1074146402 10:110720838-110720860 CCAGACCCTTCCCACATTATCAG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146401_1074146408 6 Left 1074146401 10:110720835-110720857 CCTCCAGACCCTTCCCACATTAT 0: 1
1: 0
2: 2
3: 34
4: 493
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146403_1074146408 -2 Left 1074146403 10:110720843-110720865 CCCTTCCCACATTATCAGAATAA 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146397_1074146408 24 Left 1074146397 10:110720817-110720839 CCCTCCTCTACTCAAAACCCTCC 0: 1
1: 10
2: 32
3: 154
4: 549
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146406_1074146408 -8 Left 1074146406 10:110720849-110720871 CCACATTATCAGAATAAAAGCCA 0: 1
1: 0
2: 7
3: 108
4: 622
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data
1074146398_1074146408 23 Left 1074146398 10:110720818-110720840 CCTCCTCTACTCAAAACCCTCCA 0: 1
1: 9
2: 35
3: 96
4: 556
Right 1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074146408 Original CRISPR AAAAGCCAGAGGTCCCACTA TGG Intronic
No off target data available for this crispr