ID: 1074146816

View in Genome Browser
Species Human (GRCh38)
Location 10:110724187-110724209
Sequence CCCGTTTGTCTCTGTGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074146812_1074146816 1 Left 1074146812 10:110724163-110724185 CCGTCTGCCAGTGTGTGTGCAGA No data
Right 1074146816 10:110724187-110724209 CCCGTTTGTCTCTGTGGCAGTGG No data
1074146810_1074146816 24 Left 1074146810 10:110724140-110724162 CCATCAAAAGAGACAAACAAATC No data
Right 1074146816 10:110724187-110724209 CCCGTTTGTCTCTGTGGCAGTGG No data
1074146811_1074146816 2 Left 1074146811 10:110724162-110724184 CCCGTCTGCCAGTGTGTGTGCAG No data
Right 1074146816 10:110724187-110724209 CCCGTTTGTCTCTGTGGCAGTGG No data
1074146813_1074146816 -6 Left 1074146813 10:110724170-110724192 CCAGTGTGTGTGCAGAACCCGTT No data
Right 1074146816 10:110724187-110724209 CCCGTTTGTCTCTGTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074146816 Original CRISPR CCCGTTTGTCTCTGTGGCAG TGG Intronic