ID: 1074154872

View in Genome Browser
Species Human (GRCh38)
Location 10:110789304-110789326
Sequence CCACTGCCACCAAGCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074154868_1074154872 11 Left 1074154868 10:110789270-110789292 CCACAAAATCTAAAAGGACCGCA 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG No data
1074154866_1074154872 19 Left 1074154866 10:110789262-110789284 CCGAACTGCCACAAAATCTAAAA No data
Right 1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG No data
1074154869_1074154872 -7 Left 1074154869 10:110789288-110789310 CCGCAAAGACCATCTGCCACTGC No data
Right 1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074154872 Original CRISPR CCACTGCCACCAAGCCCTTC TGG Intronic
No off target data available for this crispr