ID: 1074158020

View in Genome Browser
Species Human (GRCh38)
Location 10:110815096-110815118
Sequence TTCCCTGCCCCCTGTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074158020_1074158026 20 Left 1074158020 10:110815096-110815118 CCCCTTCCACAGGGGGCAGGGAA 0: 1
1: 0
2: 1
3: 21
4: 280
Right 1074158026 10:110815139-110815161 GACAATTCATGTGCATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074158020 Original CRISPR TTCCCTGCCCCCTGTGGAAG GGG (reversed) Intronic
900687687 1:3959088-3959110 TCCCCTGCCATCTGTAGAAGGGG - Intergenic
901150135 1:7095817-7095839 TTCCCTGCCCTCTGGTGAAAGGG - Intronic
901672261 1:10862814-10862836 TCCCCAGCCCCCAGTGGGAGTGG + Intergenic
902784221 1:18722608-18722630 TTCCCTGCCCTGTGTGGGTGAGG + Intronic
903134846 1:21302740-21302762 CGCCCTGCCCCCTTTGGAGGTGG + Intronic
903673461 1:25050137-25050159 TTCCCTGACACCTGTGGGAAGGG - Intergenic
903882035 1:26517111-26517133 TTCCCTGCCTCCTGGCCAAGAGG - Intergenic
904267423 1:29325805-29325827 GGCCCTGCCCACAGTGGAAGGGG - Intronic
904858317 1:33516552-33516574 CTTCCTGCCCCCTGGGGAACTGG + Exonic
904900408 1:33852593-33852615 CTCCCTGCCCCCAGTGGACATGG + Intronic
906670911 1:47654060-47654082 TTCCATGCACCCAGTGGGAGGGG + Intergenic
907328450 1:53656109-53656131 CCTCCTGCCCCCAGTGGAAGAGG + Intronic
907549217 1:55289840-55289862 TCCCCTGCCCCCAGTGGACACGG - Intergenic
911092507 1:94029292-94029314 CTCCCTGCACCCTCTGGGAGGGG - Intronic
911143262 1:94528441-94528463 TTTGCTTCCCACTGTGGAAGGGG - Intergenic
913109925 1:115648563-115648585 TTCCCTTCCCCCTCTGCCAGAGG - Intronic
914343597 1:146779871-146779893 CTCCCTGCTCCCTGTGGCACTGG + Intergenic
918182027 1:182092247-182092269 TTCCCTGTCCAATGTGGAGGTGG - Intergenic
918582325 1:186145791-186145813 TGCTCTGCCTCCTGTGGAGGAGG + Exonic
920176130 1:204103012-204103034 CTCCCTGCCCCCAGGGCAAGGGG - Intronic
920860077 1:209698791-209698813 ATCCCTGCCCCCAGTGGAGATGG - Intronic
921674842 1:217965864-217965886 TTCCCTGACCCCTTTGCATGTGG + Intergenic
921906887 1:220504793-220504815 CTCCCTGCTCCCTGTAGCAGTGG + Intergenic
922751771 1:228073450-228073472 CTCCCTGCCTCCTGAGAAAGGGG + Intergenic
922874143 1:228926976-228926998 CTCCCTGACCCCTGTGGACATGG + Intergenic
922874164 1:228927054-228927076 CTCCCTGACCCCTGTGGACATGG + Intergenic
924034773 1:239924899-239924921 AGCCCTGCCCCCTGGGGAGGCGG + Intergenic
1063611099 10:7562818-7562840 TTCTCTCCCCTCTGTGGATGTGG + Exonic
1064963928 10:20996239-20996261 TGCCCTACCCCCTGGGGAAAAGG - Intronic
1067046621 10:42988842-42988864 ATCCCTGCCCCATCTGCAAGTGG - Intergenic
1067290597 10:44936801-44936823 TCCCCTGTCAACTGTGGAAGGGG + Exonic
1069279593 10:66638376-66638398 TTCCCTGCATCCTCTAGAAGCGG + Intronic
1069723285 10:70562741-70562763 TCCCCTGCACGCTATGGAAGGGG - Intronic
1070749579 10:78955981-78956003 GCCCCTGCCCCCTGGGGAAGTGG - Intergenic
1071497387 10:86178540-86178562 GTGCCTGTCCCCTGTGGCAGAGG - Intronic
1072191582 10:93080625-93080647 CTGCCTGGCCCCTCTGGAAGGGG + Intergenic
1074044135 10:109820909-109820931 CTCCCTGTACCCTGTGGAAGGGG + Intergenic
1074158020 10:110815096-110815118 TTCCCTGCCCCCTGTGGAAGGGG - Intronic
1074416908 10:113274505-113274527 CTCCCTGCCCCCTGATGGAGTGG + Intergenic
1074528840 10:114282946-114282968 TTCCCTCCTCCATGTGAAAGGGG + Intronic
1074872981 10:117591916-117591938 TTCCCTGCTCACAGTGGAAGTGG + Intergenic
1075160845 10:120023365-120023387 TTCCCTGTTCCCTGTGGAGCTGG - Intergenic
1075963125 10:126586401-126586423 TTGCCTGCCCTCTGTGCCAGTGG - Intronic
1077494913 11:2882262-2882284 GTCCCTGCCCCCGGTGGAGGTGG + Intergenic
1079273692 11:19013478-19013500 TTCCCTACCCACTCTGGCAGTGG - Intergenic
1079803198 11:24896516-24896538 AGCCCTGCCCCCTGGGGCAGTGG - Intronic
1080564831 11:33498419-33498441 TCCCCTGTGCCCTGTGGAATGGG - Intergenic
1081576475 11:44321648-44321670 TTCCCTCCCAGCTCTGGAAGCGG + Intergenic
1081638121 11:44734497-44734519 TTCTCTCCCCCTTGAGGAAGAGG + Intronic
1083272501 11:61579547-61579569 GTCCCTGCCTCCTGAGGAATCGG - Intronic
1083310594 11:61781697-61781719 TGCCCTGCCCCCCAGGGAAGGGG - Exonic
1083592207 11:63902474-63902496 TTCCCTCGCCTCTGTGGAATGGG + Intronic
1083715331 11:64572036-64572058 TTCACTCCGCCCTGTGGATGAGG - Exonic
1084319307 11:68364668-68364690 ATCCCTGGTCCCTGTGGGAGTGG - Intronic
1084482016 11:69427485-69427507 TTCCCTGCAGCCAGGGGAAGTGG + Intergenic
1084717445 11:70882942-70882964 TTGCCTGCGGCCTGTGGGAGGGG + Intronic
1088196512 11:107279859-107279881 TTCCCTACCCTCTCTGGAAGAGG - Intergenic
1089991588 11:122866230-122866252 CTCACTGCCCCTGGTGGAAGAGG + Intronic
1090404470 11:126468512-126468534 TGCCCTTCCTCCTGGGGAAGGGG + Intronic
1090836621 11:130458745-130458767 CTCACTGCTCCCTGTGTAAGAGG - Intronic
1091114885 11:133003981-133004003 GTCCCTGCACCCCGAGGAAGTGG + Intronic
1091296219 11:134475690-134475712 CCCCCTGCACCCTGTGGAGGTGG + Intergenic
1092128751 12:6093698-6093720 TTCCCTCCCCACTGTGGAACAGG - Intronic
1092528897 12:9328117-9328139 TTCCCTGCCCCCTCTTCTAGGGG + Intergenic
1092731814 12:11541799-11541821 TTCCCTGCCCCCTCTTCTAGGGG - Intergenic
1097175962 12:57143073-57143095 TTCTGTCTCCCCTGTGGAAGTGG + Intronic
1097236651 12:57544993-57545015 TTGACTCCCCCATGTGGAAGTGG - Intronic
1097836090 12:64274079-64274101 TTCTCTGCCCCCCGTGACAGGGG - Intronic
1099543931 12:83951511-83951533 TTCCCTGGCCCTTTTGTAAGTGG - Intergenic
1101897771 12:108768978-108769000 TGCCCTGCCCCCTGGGGCTGCGG + Intergenic
1103553820 12:121754019-121754041 TTCTCTGTCCCCAGGGGAAGCGG + Intronic
1103805302 12:123567995-123568017 TTCACTGCAACCTCTGGAAGGGG - Intergenic
1105384423 13:19916667-19916689 TTCCCTGCCCTGTGTCCAAGTGG - Intergenic
1105411260 13:20173746-20173768 TTCCCCGCCACCTGAGGCAGAGG + Intergenic
1105866230 13:24461894-24461916 TCCCCTGCCCCATGGGGAGGTGG - Intronic
1106656638 13:31753563-31753585 CTTCCTGCTCTCTGTGGAAGTGG - Intronic
1106765674 13:32911383-32911405 TTCACAGCCCACTGTGGAGGTGG + Intergenic
1106802212 13:33267839-33267861 TTCCCTCTCAGCTGTGGAAGAGG + Intronic
1106933189 13:34689606-34689628 TGTCCTGCCCACTCTGGAAGAGG + Intergenic
1108362281 13:49678444-49678466 AGCCCTGCCCCGTGGGGAAGCGG + Intronic
1108543848 13:51470974-51470996 TTCCCAGCCTCCTGTGCAAATGG - Intergenic
1111988462 13:95090174-95090196 TTCCCTACGCACTGTGGTAGTGG + Intronic
1113296137 13:108960611-108960633 TTCCCTAACTACTGTGGAAGCGG - Intronic
1113753391 13:112791755-112791777 TCCGCTGCTCCCTGTGGAACTGG + Intronic
1115650179 14:35397515-35397537 CTTCCTGCCCCCTGTGAAAAGGG + Intergenic
1117044877 14:51803347-51803369 TTCCCTGCCCTGTGTCCAAGTGG - Intergenic
1117307322 14:54489153-54489175 TTCCCTGCTCCCTCTAGAGGAGG + Exonic
1117991537 14:61438890-61438912 TACTCTGCACCCTGTGGATGGGG + Intronic
1118719072 14:68580865-68580887 GTCCCCGCCCCGTGTGGAAATGG - Intronic
1121104278 14:91270695-91270717 TTGCATGCCCCCTGTGGTGGTGG + Intergenic
1121999599 14:98635930-98635952 CTCCCTGGCCCCTGTAGAAAGGG - Intergenic
1122159045 14:99769458-99769480 GTCCCTGCCCACTGTGGGGGAGG - Intronic
1122635246 14:103126763-103126785 TTGCCGGCCCACTGTGCAAGTGG - Intronic
1122890148 14:104728455-104728477 TTCTCTGCCCCTTTTGGTAGTGG - Intronic
1123121278 14:105918199-105918221 CTCCCTGGCCCGTGTGTAAGTGG + Intronic
1123404004 15:20009863-20009885 CTCCCTGGCCCATGTGTAAGTGG + Intergenic
1123513343 15:21016509-21016531 CTCCCTGGCCCATGTGTAAGTGG + Intergenic
1124239994 15:28020761-28020783 CGCCCTGACCCCAGTGGAAGTGG + Intronic
1125083803 15:35706273-35706295 TTCTCTGGCCTCTCTGGAAGTGG + Intergenic
1125411986 15:39415710-39415732 TTCCCTGCCCCAGCTGGAAGTGG + Intergenic
1125431716 15:39602077-39602099 ATCCCTGCAACCTGTGAAAGGGG + Intronic
1127298007 15:57626996-57627018 TTCCCTTCCTCCTGTGGTCGGGG + Intronic
1127670190 15:61187572-61187594 TGCGCTGTTCCCTGTGGAAGAGG - Intronic
1128800311 15:70492885-70492907 CTAACTGCCCCCTGGGGAAGTGG + Intergenic
1129109901 15:73331179-73331201 TTCCAGTCCCCCTGTGGATGAGG - Intronic
1129605114 15:77021024-77021046 TTCCCTGCCCCTTGCAGAACGGG + Intronic
1129741102 15:77990009-77990031 TGCTCAGCCCCCTGTGGCAGTGG + Intronic
1130093075 15:80837369-80837391 TTCCCAGGCTCCTTTGGAAGAGG + Intronic
1132895389 16:2226736-2226758 TTGCCAGCACCCTGTGGAAATGG - Intronic
1133011645 16:2915893-2915915 TTCCTTGGCCACTGTAGAAGAGG - Intronic
1135046209 16:19158027-19158049 TTTCATGCTCCCTATGGAAGTGG + Intronic
1136223601 16:28844434-28844456 TTTCCTGCTGCCTGTGGAGGCGG - Exonic
1137623928 16:49895614-49895636 TTCTCTGGTCCCTGTGGAGGAGG - Intergenic
1138131384 16:54482784-54482806 TTCCCAGGCCCCACTGGAAGTGG - Intergenic
1138381109 16:56603234-56603256 ATCCCTGCCCCATATGGCAGGGG + Intergenic
1139990394 16:70935463-70935485 CTCCCTGCTCCCTGTGGCACTGG - Intronic
1140880029 16:79189781-79189803 TTACCTGCTCCCGGTGGGAGGGG + Intronic
1140930484 16:79623114-79623136 CTCCCTTCCCACTGTGGGAGGGG - Intergenic
1141545612 16:84766206-84766228 TTTCCCGTCCTCTGTGGAAGTGG + Intronic
1141564483 16:84892121-84892143 TTACCTGCCCCCTGGGGTGGTGG + Intronic
1141612396 16:85189412-85189434 TTCCTTGCCAGCTGTGGGAGTGG + Intergenic
1141905947 16:87027318-87027340 ATCACTGCCCCTTGGGGAAGAGG - Intergenic
1142191545 16:88720522-88720544 TGCCCTGGGCCCTGCGGAAGGGG + Exonic
1142599289 17:1045622-1045644 TTCCCAGGACCCTGTGGGAGAGG - Intronic
1143757911 17:9079974-9079996 TTTCCTGGCCCCCGAGGAAGTGG + Intronic
1144686228 17:17228034-17228056 TTCCCATCCCCTTGAGGAAGTGG + Exonic
1146943318 17:36858701-36858723 TTCCCTGTCTCCTGGGGAGGAGG + Intergenic
1147988207 17:44318525-44318547 TCCCCTGCCCCCTCAGGAACTGG + Exonic
1148474291 17:47916833-47916855 CTCCCAGCCCCCTGTGGCTGTGG + Exonic
1149531901 17:57402287-57402309 TCCTCTGGCCCCTGTGGAAATGG + Intronic
1151668127 17:75557314-75557336 CTCTCTGCCGCCTGTGGGAGTGG - Intronic
1152037287 17:77881159-77881181 CTCCCTGCCCCAGGTGGAAGGGG - Intergenic
1152068017 17:78122024-78122046 TTTCCTGTTCCCTGTGGATGTGG + Intronic
1154141922 18:11831701-11831723 TCCCCTGCTCCCTCTGGAATTGG - Intronic
1155422697 18:25672578-25672600 TTCCCTGCCTCCTCTGCCAGGGG + Intergenic
1156361716 18:36389724-36389746 TTCCCTGCTCTCTCTGGAATAGG - Intronic
1157104976 18:44765518-44765540 TTCTCTGAGCCCTGTGGAAATGG + Intronic
1158099899 18:53819144-53819166 TTCCCTGCCACCTCTTTAAGTGG - Intergenic
1160856017 19:1218321-1218343 TCCCCATCTCCCTGTGGAAGTGG - Intronic
1160967239 19:1752158-1752180 TTTCCTGGCCCCTGTAGACGTGG - Intergenic
1161493640 19:4575980-4576002 TGCCCTGCCCCCAGAGAAAGGGG + Intergenic
1163326175 19:16604762-16604784 TTCCCTGCCCCCTGTAGCTAGGG - Intronic
1163687265 19:18718984-18719006 CTCCCTGCTCCCTCTGCAAGTGG - Intronic
1164453051 19:28383098-28383120 TGCCATGCCACCTGTGGAAAAGG - Intergenic
1164581996 19:29440245-29440267 AGCCCTGCCCCCTGGGGAGGCGG - Intergenic
1165147278 19:33739027-33739049 TTGCCTGATCCCTGTGGATGCGG - Intronic
1165167230 19:33865367-33865389 TTGCCCGAGCCCTGTGGAAGAGG + Intergenic
1165994305 19:39833454-39833476 CTCCCCGCCCCCGGTGGCAGTGG - Exonic
1166544676 19:43626916-43626938 TTCCCTTCTCCCTGCGGCAGTGG - Exonic
1166749666 19:45158895-45158917 CTCCCAGCCCCCTGCGGCAGCGG - Exonic
1166827330 19:45617577-45617599 TTCTCTGCTCCCTGGGGAACTGG - Intronic
1168126596 19:54286754-54286776 TTCCCTCGCCCCTGTGGAACAGG + Intergenic
1168224377 19:54983773-54983795 TCCCATGCCCCCTTAGGAAGAGG + Intronic
925988432 2:9234580-9234602 TTCACAGCCACCTGGGGAAGTGG + Intronic
927645307 2:24873522-24873544 GTCCCTACAGCCTGTGGAAGTGG - Intronic
927805522 2:26143408-26143430 TTCCCTGGCACCTGGGGCAGGGG - Intergenic
927828397 2:26326440-26326462 TTCCTTTCCCTCTGTGGAAATGG + Intronic
928640701 2:33295864-33295886 TTCCCTACTGCCAGTGGAAGAGG - Intronic
930182409 2:48375110-48375132 TTCCCTGTCTTCTGTGGATGAGG + Exonic
934037764 2:88103051-88103073 TTCCCAGCCCTCTCAGGAAGTGG + Exonic
934749412 2:96783208-96783230 TTCCCTGCCACCTCTGGTAGGGG + Intronic
934768488 2:96893863-96893885 TTCCCTGCTACCTGTGGTGGTGG + Intronic
935259064 2:101339025-101339047 TTCCCTCAGCCCTGAGGAAGGGG + Intergenic
936345775 2:111673786-111673808 ACCCCTGCCCCATGTGCAAGGGG + Intergenic
939473749 2:142658969-142658991 TTCCCTCCCACCTGCAGAAGAGG + Intergenic
940896834 2:159089123-159089145 AGCCCAGCCCACTGTGGAAGGGG - Intronic
942598810 2:177619058-177619080 TTCCCTGCCCCCTAAAGATGAGG + Intergenic
945029556 2:205650647-205650669 TTCCCAACCCCCTCTGGAATGGG + Intergenic
946215875 2:218183323-218183345 TTCCCTGACCCCTTTGCAGGTGG + Intergenic
948833874 2:240614602-240614624 TCCCCTTGCCCATGTGGAAGGGG + Intronic
948968302 2:241402261-241402283 TTCCCAGCACTCTGTGAAAGTGG + Intronic
1169131139 20:3166940-3166962 TTCCCTGGCCCCCGAGGCAGTGG - Exonic
1173869170 20:46330909-46330931 ATCCCTGTCCACTATGGAAGGGG + Intergenic
1174368103 20:50068493-50068515 TTCCCTGCCCCCAGTGGCTCAGG - Intergenic
1174784471 20:53419653-53419675 TTGACTGCCCGCTGTGGAAGGGG - Intronic
1176010795 20:62893900-62893922 TGCCCAGCCTCCTGTGGGAGCGG - Exonic
1178885537 21:36482012-36482034 TTCCCTGCCCACTCAGGGAGAGG - Intronic
1179044422 21:37831850-37831872 ATACCTGCCCACTATGGAAGAGG + Intronic
1180022810 21:45139590-45139612 TTCCCTGCCCCACGTGACAGAGG - Intronic
1181042794 22:20200546-20200568 ATCCCTGCCCTCAGTGGAGGAGG + Intergenic
1181273513 22:21674344-21674366 TTACCTGCCACCTGGGGTAGGGG + Intronic
1182120455 22:27783062-27783084 TTCCCTTCCTCTTGTGGAGGTGG - Intronic
1183319403 22:37155931-37155953 TCCCATGGCCCCTGTGAAAGAGG - Intronic
1183363583 22:37395648-37395670 TCCCCTGCCCCCCGTGGGTGAGG - Intronic
1183393547 22:37559685-37559707 TTCCCTGCCCTCCATGGAGGTGG + Intergenic
1184023704 22:41838135-41838157 TTTCCTGATCCCAGTGGAAGAGG - Intronic
1184250903 22:43259761-43259783 TCCTCAGCTCCCTGTGGAAGAGG - Intronic
1184852156 22:47127167-47127189 CTCCTTGCCCCATGTGGAATTGG + Intronic
1185370764 22:50459879-50459901 TTCCCTGCCCGCTGTGGGCCTGG - Intronic
949676741 3:6463258-6463280 TTCCCTGGCTCCTGAGGCAGTGG - Intergenic
952897236 3:38085746-38085768 TTCCTTGCCCACTGTGGCACAGG - Intronic
953673228 3:44980016-44980038 TCCCCTGGCCCCTTTGGAATAGG - Intronic
955522507 3:59788499-59788521 TTCCCTGCCTCCTGTGGTTAGGG + Intronic
955530326 3:59866153-59866175 TTCCCTGTCCTCTCTGCAAGTGG - Intronic
960612787 3:119570396-119570418 TTCCCTGTCCCCTGAGAAACAGG + Intergenic
961203008 3:125059186-125059208 TTCCCAGCCCCCTGTGCAGTTGG - Intergenic
961825197 3:129595647-129595669 TTCCCTGACCCCTCTGGAAGAGG + Intronic
962176751 3:133163302-133163324 TTCCCTGTCCAGTGGGGAAGAGG + Intronic
963017510 3:140839910-140839932 TTACCTGTTCCCTGAGGAAGAGG + Intergenic
963264602 3:143228245-143228267 TTCCCAGCAGCCTGTGGAGGAGG - Intergenic
963264630 3:143228379-143228401 TTCCCAGCAGCCTGTGGAGGAGG + Intergenic
963471611 3:145748767-145748789 TTCCCTTCTCCCTGTGGCACTGG + Intergenic
966385466 3:179393055-179393077 TTTCTTCCCCACTGTGGAAGAGG + Exonic
967881701 3:194306227-194306249 TTCCCTTCCCCCAGGGCAAGAGG + Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
972780289 4:42281153-42281175 TTCACTGCACCCGGAGGAAGCGG + Intergenic
974391335 4:61273767-61273789 TTCCCCGCACCCCGTGGAATTGG + Intronic
974534208 4:63153913-63153935 TTCACTGTCTCCTGTGGAATTGG + Intergenic
976631425 4:87241115-87241137 TTCACTCCACCATGTGGAAGTGG - Intergenic
978994419 4:115131745-115131767 TTCCCTGCCTCCTGTGGTGCTGG - Intergenic
979794871 4:124834247-124834269 TTCCCTGCCCCCGCTGGTAGCGG - Intergenic
981624219 4:146737840-146737862 TTCCCTCCCCCCTGATGCAGTGG + Intronic
983409746 4:167381139-167381161 CTCCCTCCCCCATGAGGAAGTGG + Intergenic
985640006 5:1059158-1059180 TGCCCGGACCCCCGTGGAAGGGG + Intronic
986145657 5:5074953-5074975 TTCCCTTTCCCCTGTGAAAAAGG + Intergenic
986387214 5:7246621-7246643 ATCCCTGACCCCCATGGAAGGGG + Intergenic
990128486 5:52548828-52548850 TTCCCTGACCCCTTTGCAGGTGG - Intergenic
990256984 5:53981010-53981032 TGCCCTGCCCCCTTTGCCAGAGG + Intronic
990663779 5:58049056-58049078 TACCCTCCCCCCTTTGGCAGGGG + Intergenic
992206294 5:74433588-74433610 TTCCCTCCCCGCTGTGGATATGG + Intergenic
993386631 5:87268874-87268896 TTACCTGCCCCCTTTGGGGGCGG + Exonic
995864229 5:116674106-116674128 TTCACTGCCCATTGGGGAAGAGG - Intergenic
996457967 5:123707017-123707039 TTTTCTGCCTACTGTGGAAGGGG - Intergenic
996565479 5:124875691-124875713 TTTCTTCCCCACTGTGGAAGAGG - Intergenic
998407625 5:141882991-141883013 TTTGCTGCCTCCTGAGGAAGGGG + Intergenic
1000996925 5:167968870-167968892 TTACAAGCCCCCTGTGCAAGGGG + Intronic
1001235027 5:170022215-170022237 TTTCCTGCCTCCTGGGGCAGTGG + Intronic
1002454257 5:179337277-179337299 TTTCCTGCACTCTGTAGAAGAGG - Intronic
1002794218 6:457748-457770 GTTCTTACCCCCTGTGGAAGTGG - Intergenic
1003228226 6:4225490-4225512 TGCCCTGCCCCCAGAGGTAGAGG - Intergenic
1003658213 6:8034433-8034455 TTCCCTGCCCTGTGTCCAAGGGG - Intronic
1004025920 6:11818484-11818506 CTTCCTGCTACCTGTGGAAGAGG + Intergenic
1004285765 6:14318996-14319018 TTCCCTGCATGCTGAGGAAGGGG + Intergenic
1004495075 6:16155568-16155590 TTCCCTGACCCCTTTGCAAGTGG + Intergenic
1004561826 6:16760082-16760104 TTCCCTGCCCCCTGCGGGACCGG + Intronic
1004934196 6:20491571-20491593 TTCCCGGGCCCCTGTGACAGGGG + Exonic
1005751290 6:28885275-28885297 TGCCCTGCCCCATGAGGAGGCGG + Intergenic
1005900777 6:30214565-30214587 TTCCCTACCCCCAGCGGAGGAGG - Intergenic
1006414538 6:33895654-33895676 TTTCCTGGCCCATGTGGCAGAGG + Intergenic
1006938626 6:37736458-37736480 TTCCCTGCCCCATTTGCAACTGG + Intergenic
1007254476 6:40519060-40519082 TTCCCTGACCCCTGCAGAAGGGG - Intronic
1007417221 6:41698827-41698849 TTCTCAGCCCCCTCTGGCAGAGG + Intronic
1007809730 6:44477205-44477227 TTCATGGCCCCCTGTGGAAGTGG - Intergenic
1008208058 6:48687070-48687092 TGCCCTGCCCCTTCTGGCAGTGG + Intergenic
1008538362 6:52525279-52525301 TTCCCTGCCACCTGGGGGAGTGG - Intronic
1008933342 6:56962819-56962841 TTCCATGCCTTCTGGGGAAGTGG - Intronic
1010059874 6:71610429-71610451 TTCCCAGCACGCAGTGGAAGAGG - Intergenic
1010500587 6:76594420-76594442 TCCCCTTTCCCCTGTGGATGAGG - Intergenic
1016892949 6:149024516-149024538 TTCCGTGTCCCCTGAGGCAGAGG + Intronic
1017998433 6:159555732-159555754 TTCCATGCCCCATGAGGAAATGG - Intergenic
1018443380 6:163834022-163834044 TTCCAGGCCACCGGTGGAAGAGG + Intergenic
1019777498 7:2921318-2921340 TTCTCTGCCTCCTGTGAAAACGG + Intronic
1021639381 7:22722986-22723008 TTACCTTCCCCCTGCTGAAGTGG - Intergenic
1021849196 7:24791146-24791168 TTCCTTGACCACTGTGGGAGTGG + Intergenic
1022452374 7:30526479-30526501 GTCCCTGCCCACTCTGGGAGAGG + Intronic
1022945875 7:35282930-35282952 TTCTCTGCCTCCTAGGGAAGTGG - Intergenic
1025091660 7:56069253-56069275 ATCCCTTCCCCATGTAGAAGAGG - Intronic
1025603743 7:63023953-63023975 TTCCATGCCTCCTGGGGAATGGG + Intergenic
1026819836 7:73539707-73539729 CTCCCTTCCCTCTGTGAAAGGGG + Intronic
1028385559 7:90249263-90249285 TTTCCTGCCACCTGTGAAGGAGG + Intronic
1028980303 7:96960893-96960915 TTCACTTCCCCATTTGGAAGAGG + Intergenic
1029495128 7:100892462-100892484 TCTCCTGGCCCCTGTGGATGGGG - Exonic
1032091074 7:128911834-128911856 CTCCCTGCCCCCTGTGGCAAAGG - Intergenic
1034275435 7:149821900-149821922 TGCCCTGTCTCCTGTGGAGGTGG + Intergenic
1034784750 7:153915649-153915671 ATCTCTGCCCCCAGTGGTAGGGG - Intronic
1035352307 7:158255373-158255395 TTCCCTGTTCCCTGTGGCCGTGG - Intronic
1035917518 8:3641283-3641305 TTCCCAGCCTCCTGTGCAGGTGG + Intronic
1037971714 8:23176721-23176743 CTCCCTTCCCTCTGGGGAAGGGG + Intergenic
1038703503 8:29873111-29873133 TTCCCTGCCACCTTGTGAAGAGG + Intergenic
1039403641 8:37294312-37294334 TTTCCTGCCCTCTGTGGAGCAGG - Intergenic
1040387252 8:46921846-46921868 TTGCCTGCGTTCTGTGGAAGTGG - Intergenic
1042159157 8:65874733-65874755 TTCCTTACCCCCTGTGGCAGAGG + Intergenic
1042786990 8:72558945-72558967 TTCCCTGTTCCCTGTGGCAGAGG + Intronic
1044134955 8:88574631-88574653 TTCCCTGCCCCCAGAGGTGGAGG - Intergenic
1045860693 8:106812210-106812232 TTCCCTGCCCCCAGTCCCAGAGG - Intergenic
1047658162 8:127001524-127001546 TTCCCTCCCCAATGTGCAAGAGG - Intergenic
1048931338 8:139317721-139317743 GCCACTGCCCCTTGTGGAAGGGG + Intergenic
1049806636 8:144543958-144543980 TTCCCAGGCCCCTCTGGAAGAGG + Intronic
1050253532 9:3770758-3770780 TCCTCAGCCCCCTGTGGGAGGGG + Intergenic
1052916473 9:33927377-33927399 TTCCTTGCCCTCTTTGGAGGAGG - Intronic
1057185589 9:93055922-93055944 TTCCCTGATCCCTGGGGCAGGGG - Intergenic
1057267608 9:93629648-93629670 TTCCCTGCCCCCTGGGTGACGGG + Intronic
1057643839 9:96854342-96854364 ATCCCCGCCCCCTGTGTCAGTGG - Exonic
1057723928 9:97554990-97555012 TTCCCTGTCTCCTGAGGAAAGGG - Intronic
1058213415 9:102201801-102201823 TTCCTTGACTCCTCTGGAAGTGG + Intergenic
1058920401 9:109609065-109609087 TTCCCTGCTCCCTGTGTGATGGG + Intergenic
1059340881 9:113597014-113597036 CTCCCTGCCCCCTGTGACGGAGG + Exonic
1060153426 9:121302846-121302868 ATCCCAGACCCCTGAGGAAGAGG - Intronic
1060157391 9:121329157-121329179 TTATCTGCCCCCTGAGGGAGTGG - Intronic
1061138456 9:128750404-128750426 CTCCCTGCCCCATGTGGGGGTGG - Intronic
1061387282 9:130297876-130297898 TGGCCTGTCCCCAGTGGAAGTGG + Intronic
1061528589 9:131191154-131191176 TTCCTTTCCCCCTTTTGAAGTGG + Intronic
1062584695 9:137243999-137244021 CTCCCTACCCCTTTTGGAAGGGG - Intronic
1062601627 9:137320996-137321018 TTCCTTGCCACCTGAGGCAGAGG + Intronic
1185612072 X:1398760-1398782 TTCCCCGCCCCGGGTGGCAGGGG + Intergenic
1187681436 X:21771114-21771136 TTCCCTACCCACCGTGGTAGTGG + Intergenic
1189879166 X:45471298-45471320 TTCCCTACCCACCCTGGAAGTGG - Intergenic
1193720001 X:84975105-84975127 ATCCCTGCCCCGTGGGGAGGCGG - Intergenic
1194444969 X:93976005-93976027 TTCACTGCCACCAGTGGCAGGGG + Intergenic
1197469620 X:126851352-126851374 TTCCCCGCCCCATGTTCAAGGGG - Intergenic
1197744080 X:129919243-129919265 TTTACTGACCCCTGTGGAAAAGG + Exonic
1198092087 X:133341655-133341677 TTCCCTGCCCCCAGTGTACATGG + Intronic
1198244963 X:134821530-134821552 TCCCCTGCTTCCTTTGGAAGAGG - Intronic