ID: 1074163555

View in Genome Browser
Species Human (GRCh38)
Location 10:110855134-110855156
Sequence GATGCCACACCCACTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074163555_1074163560 16 Left 1074163555 10:110855134-110855156 CCTCCCACAGTGGGTGTGGCATC No data
Right 1074163560 10:110855173-110855195 CACACTCTAAATACAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074163555 Original CRISPR GATGCCACACCCACTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr