ID: 1074164610

View in Genome Browser
Species Human (GRCh38)
Location 10:110864046-110864068
Sequence CTGCAAAGTGCAGTGGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074164607_1074164610 4 Left 1074164607 10:110864019-110864041 CCAGTGATGGTGGGCTGGACAAG No data
Right 1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074164610 Original CRISPR CTGCAAAGTGCAGTGGTGGC CGG Intergenic
No off target data available for this crispr