ID: 1074167738

View in Genome Browser
Species Human (GRCh38)
Location 10:110899822-110899844
Sequence GACAGTTTTGTCATTACTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074167738 Original CRISPR GACAGTTTTGTCATTACTGG TGG Exonic
903540010 1:24091549-24091571 GACACATTTGTCATTAGTGGTGG - Intronic
905288957 1:36908261-36908283 GACAGGGGTGACATTACTGGGGG + Intronic
909417644 1:75425674-75425696 TACAGCATTGTTATTACTGGAGG - Intronic
909715040 1:78697829-78697851 GACAGTTTTTTTATTTCTGTGGG + Intergenic
914202734 1:145501008-145501030 GTCAGTTTTGTCATTTCTGATGG - Intergenic
914236664 1:145818936-145818958 GTCAGTTTTGTCATTTCTGATGG - Intronic
914481857 1:148074159-148074181 GTCAGTTTTGTCATTTCTGATGG - Intergenic
916211267 1:162361940-162361962 GACATTGTGGTCAGTACTGGAGG - Intronic
918084757 1:181236190-181236212 GATTGTTTTGTTATTGCTGGTGG + Intergenic
924602356 1:245502789-245502811 AACTGTTTTGTCATGACAGGGGG + Intronic
924751375 1:246894937-246894959 GACAGTTTTTGCATTTTTGGCGG - Intronic
1063029398 10:2217619-2217641 GCCAGTTGTCTCATTACTGTAGG + Intergenic
1064688962 10:17894213-17894235 GACTGTGTTGTTATTATTGGAGG + Exonic
1064849525 10:19695289-19695311 GCTAGATTTGCCATTACTGGTGG + Intronic
1065147009 10:22779769-22779791 GCCAGCTCTGTCATTCCTGGAGG + Intergenic
1066341022 10:34533892-34533914 GACTGTTTTGCCATTTCTAGTGG - Intronic
1071365416 10:84894648-84894670 GACATTTTTTTCATACCTGGAGG - Intergenic
1073982646 10:109172556-109172578 GATGGTTTTATCATTACTGCAGG + Intergenic
1074167738 10:110899822-110899844 GACAGTTTTGTCATTACTGGTGG + Exonic
1074799447 10:116984688-116984710 GAGGGTTTTGTCATTATTGAGGG - Intronic
1078253324 11:9636414-9636436 TACACTTTTGGCATTACTGCAGG + Intergenic
1085333497 11:75671841-75671863 GTCATCTTTGCCATTACTGGTGG + Intergenic
1090711429 11:129389911-129389933 GACAGCTTTTAAATTACTGGTGG + Intronic
1091554609 12:1563206-1563228 GACAGTTTCCTCATTCCTCGTGG + Intronic
1092854241 12:12657707-12657729 GACAATTTTGTCCTTGGTGGAGG - Intergenic
1094624451 12:32109427-32109449 CACATTTTTCTCATTACTGCTGG - Intronic
1095915402 12:47473015-47473037 GACAATTTTTCCATGACTGGGGG - Intergenic
1097746387 12:63308438-63308460 AACAATTTTGACATTACTGGAGG - Intergenic
1098972933 12:76874901-76874923 GACAGTTTTTTCATGGATGGTGG - Intronic
1099549593 12:84026425-84026447 GAAAGTTTTTACATTATTGGTGG + Intergenic
1099556708 12:84117971-84117993 GAAAGTTTTGTCATTAGAGAAGG + Intergenic
1100145096 12:91668106-91668128 GACAGGTTTCACTTTACTGGGGG - Intergenic
1100555834 12:95692896-95692918 GTCAGTTTTCTCATTAATGAAGG + Intronic
1105802584 13:23921590-23921612 TACAGTTTTTTCATTACAGAAGG + Intergenic
1108369510 13:49753845-49753867 GACAGTTTTTCCATGAATGGCGG - Intronic
1108588126 13:51889100-51889122 CACATTTTCGTTATTACTGGTGG + Intergenic
1109581787 13:64348769-64348791 GAGACTTTTGTCACTCCTGGAGG - Intergenic
1110514477 13:76393650-76393672 GAAAGTCTTTTCATTCCTGGAGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115341037 14:32293062-32293084 CATTGTTTTGTCTTTACTGGAGG + Intergenic
1115628084 14:35215489-35215511 GACAGTTTTGTCAGATGTGGTGG + Intronic
1115842986 14:37492875-37492897 GACATTTTTGTCACAACTGGTGG - Intronic
1117354271 14:54908635-54908657 GACATTTTTGTCATTAATAATGG - Intergenic
1119940092 14:78631442-78631464 CACAGTTTTGTCATAACTCGTGG + Intronic
1120635459 14:86944931-86944953 GACTATTTTTTCATTAATGGTGG + Intergenic
1126007400 15:44271207-44271229 GACAGTTCTATCAGTGCTGGGGG - Intergenic
1127379104 15:58413789-58413811 GACAGTTTTTCCATGAATGGGGG - Intronic
1130069501 15:80634654-80634676 TCCAATTTTGTCATTACTGCTGG + Intergenic
1133619590 16:7513615-7513637 GACAGTTTTGTCACAAATGAGGG - Intronic
1133822023 16:9245415-9245437 GACAGTTTTGCCATTTCTCCAGG - Intergenic
1135117688 16:19737509-19737531 GACAGTTGTGTCTTTACTTGAGG + Intronic
1138648097 16:58439848-58439870 GGCAGATTTGTGATTACTGTTGG + Intergenic
1139251939 16:65505129-65505151 CACAGCTCTGTCATTTCTGGGGG + Intergenic
1144831020 17:18131267-18131289 GACGGTTTTGGCATTACCGAAGG - Exonic
1153111773 18:1599030-1599052 AACAGTTTTCTCATTACTGTTGG - Intergenic
1155635256 18:27945544-27945566 AAAAGTTTTTTCCTTACTGGGGG - Intergenic
1155701301 18:28747337-28747359 GAGAGTTTTGTGATTGCCGGGGG - Intergenic
1156361385 18:36387265-36387287 GACACTTTTGTCAAAAATGGGGG + Intronic
1157775018 18:50387120-50387142 GAATGTTCTGTCATTGCTGGTGG - Intronic
1161076393 19:2287951-2287973 GACAGTTAGGACATTGCTGGGGG - Intronic
1162616893 19:11809005-11809027 AACAGTTTTTTTAGTACTGGTGG - Intronic
1163279063 19:16304089-16304111 CACAGTATTGGCATGACTGGGGG + Intergenic
925624170 2:5825733-5825755 GACAGTTTTTTCATGAATGCAGG + Intergenic
933569063 2:83987419-83987441 CACAGTTTTGTGGTTTCTGGGGG - Intergenic
934636683 2:95995747-95995769 GTAAGTTTTGTCTTTAGTGGTGG - Intergenic
934796967 2:97109677-97109699 GTAAGTTTTGTCTTTAGTGGTGG + Intergenic
936545354 2:113387695-113387717 GTAAGTTTTGTCTTTAGTGGTGG + Intergenic
937392375 2:121501006-121501028 CACAGTTTTGGCATTCCTGAGGG + Intronic
937439071 2:121901810-121901832 CACAGTGTTGTCATGAGTGGTGG - Intergenic
941555898 2:166981190-166981212 GACATTTTTCTCAGTTCTGGAGG + Intronic
943652214 2:190469400-190469422 GCCAGTAATGTCATTACTGATGG + Intronic
945174917 2:207033915-207033937 GGAAGTTTTGTCCTTTCTGGTGG + Intergenic
949000907 2:241612432-241612454 GACAGGTGTGTCATTTCTGCTGG - Intronic
1169453594 20:5732971-5732993 GACATTTTTGTCACAACTGCAGG + Intergenic
1169551184 20:6703124-6703146 GACATTTTGGTCATTACGGTTGG - Intergenic
1170079885 20:12462953-12462975 GTCAGTGTTGTCATTAATTGAGG + Intergenic
1172494310 20:35367870-35367892 CCCAGTTTTGTCATTTCTGGGGG - Intronic
1173258145 20:41409682-41409704 GACATTTTTGAGATAACTGGTGG + Intronic
1175261624 20:57678090-57678112 GACTGTTGTGTCTTGACTGGTGG + Intronic
1175662831 20:60831602-60831624 CTCAGTTTTGTCTCTACTGGTGG + Intergenic
1179321162 21:40292333-40292355 TACAGTTTTGTCATTTATGAGGG + Intronic
1181758018 22:25039114-25039136 TTCAGTTTTGTCATGTCTGGTGG - Exonic
950948646 3:16976745-16976767 GACAGTGTTGTCCTTATTTGTGG + Intronic
952019716 3:29003182-29003204 GAAACTCTTATCATTACTGGTGG - Intergenic
955985081 3:64564704-64564726 GACAGTTTTGTCACAAGTTGGGG - Intronic
960042426 3:113164114-113164136 GACAGTTTGGTGATTCCTCGAGG + Intergenic
960314155 3:116155894-116155916 AACAGTTTTGCAATTACTGTGGG - Intronic
960871887 3:122258417-122258439 GATAGTTTTGTCATCATTGACGG + Intronic
961981600 3:131084972-131084994 GAAAAATTTGTCATTATTGGTGG + Intronic
963958161 3:151278557-151278579 GACTGTTTTTGCATTACTGGAGG - Intronic
964272557 3:154973520-154973542 GACTATTTTGTGATTACTGTTGG - Intergenic
965930571 3:174037978-174038000 TATATTTTTATCATTACTGGAGG - Intronic
971564626 4:28121598-28121620 GACTGTCTTTTCATTATTGGTGG - Intergenic
973873351 4:55188654-55188676 GAGGGTTTTCTCATTACTGTTGG - Intergenic
976841091 4:89433183-89433205 GATAGTTTTTTCACTAATGGGGG - Intergenic
978038598 4:104028894-104028916 GACAGTTTTGTCAGTTCTGCAGG - Intergenic
982409486 4:155058375-155058397 AACAGTTATTTCATTACTTGAGG - Intergenic
984224889 4:177022813-177022835 GACAGTGTTGTGATTCCTGAAGG + Intergenic
984757559 4:183338128-183338150 GTCATTTCTGTCATTGCTGGGGG - Intergenic
985241462 4:187934992-187935014 GCCAGTTGTGTTATTACTGCAGG - Intergenic
985376320 4:189343224-189343246 AACAGTTTTTTCATGACTGATGG - Intergenic
986486664 5:8244895-8244917 GATAGTTTTGTCATCGCGGGTGG + Intergenic
993760880 5:91795823-91795845 GGCAGTTTTATCTTTAGTGGGGG - Intergenic
994521025 5:100835507-100835529 TACAGTATTGCTATTACTGGTGG + Intronic
994616959 5:102116060-102116082 GTCATTTTTGTCATCACTGGTGG + Intergenic
995316363 5:110779007-110779029 GACAGTTTGGTGATTACTCAAGG - Intergenic
997556139 5:134800456-134800478 CACAGTTTAGTCATTTCTGTTGG + Intronic
1001866619 5:175111633-175111655 CTCAGTTTTGTCATCACTGAAGG + Intergenic
1012641026 6:101614030-101614052 GATAAGTTTGTCATTCCTGGAGG + Intronic
1013352777 6:109320244-109320266 GACTATTTTCTCATTACTTGTGG - Intergenic
1014231173 6:118904210-118904232 AACATTTTTTTCATTTCTGGAGG - Intronic
1020184283 7:5947039-5947061 GACAGTTTTTCCATGAATGGTGG + Intronic
1020298634 7:6777727-6777749 GACAGTTTTTCCATGAATGGTGG - Intronic
1021421686 7:20452321-20452343 GACACTTTTCTCATTAATAGTGG + Intergenic
1021695054 7:23268339-23268361 GCAAGTTTTGTGATCACTGGTGG - Intronic
1024198096 7:47079861-47079883 GACAGTTTTGTCAACCCTTGGGG - Intergenic
1026453986 7:70554873-70554895 CACAGTGTTGTCATCACAGGAGG - Intronic
1028461755 7:91102026-91102048 GACAGACTTGTCTTTATTGGTGG + Intronic
1028669707 7:93387424-93387446 GCCAGCTTTGTATTTACTGGCGG - Intergenic
1028741458 7:94280430-94280452 GAAAGTTTTGTCATTATCGTGGG - Intergenic
1032641753 7:133777552-133777574 GACAGTGTTATGATTATTGGTGG + Intronic
1033729185 7:144157809-144157831 GAAATTTTTGTCTTTGCTGGTGG + Intergenic
1040476748 8:47785081-47785103 TACAGTTTTGTCACCCCTGGAGG + Intronic
1041491739 8:58440303-58440325 AAGAGTTTGGTCATTACTGATGG - Intronic
1042071350 8:64938643-64938665 GACAGTTGTGTTATCACTTGGGG - Intergenic
1042488200 8:69369676-69369698 GTCAGTTTTGCCATTGCTGGAGG + Intergenic
1043596609 8:81894843-81894865 TCCAATTTTGTCATTACTTGAGG + Intergenic
1046478080 8:114775622-114775644 GACAAATTTGTCATTACTATTGG + Intergenic
1047155025 8:122307320-122307342 GACAGATCTGTCATTACTGTGGG - Intergenic
1050285982 9:4102502-4102524 GACATGTTTGTCACTACTGAGGG + Intronic
1051963217 9:22793593-22793615 GGCATTTTTCTAATTACTGGGGG + Intergenic
1057443269 9:95096987-95097009 GAAAGTTTTGTCACCACTGGTGG + Intergenic
1186071431 X:5825697-5825719 CACAGAATTGTCCTTACTGGGGG + Intergenic
1186348271 X:8716960-8716982 ATCAGTTTTGTCATGACTGAAGG + Intronic
1186654152 X:11594717-11594739 GACAGTTTTTTCATAGGTGGTGG - Intronic
1187444101 X:19345270-19345292 GGCAGTTTTGTCATTATTTTAGG - Intronic
1187864977 X:23715625-23715647 GACACTGTTGGCATTTCTGGTGG - Intronic
1189386935 X:40544831-40544853 GAGAGTTTTGCCATCACTGAGGG + Intergenic
1193083365 X:77426886-77426908 CACAGATTTGTCATAACTGCAGG + Intergenic
1193240574 X:79164392-79164414 CACAGAGTTGTCATCACTGGTGG + Intergenic
1195318586 X:103702389-103702411 GACAGTGTAGTGATTACTGGTGG - Intergenic
1195580901 X:106501491-106501513 TACAGTGTTGTAATTACTGTGGG + Intergenic
1196244612 X:113385965-113385987 GACAGTTTGGTGATTCCTGAAGG - Intergenic