ID: 1074168053

View in Genome Browser
Species Human (GRCh38)
Location 10:110903556-110903578
Sequence AAGTGTAGCCCAGCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074168053_1074168055 0 Left 1074168053 10:110903556-110903578 CCAGCACTGGCTGGGCTACACTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1074168055 10:110903579-110903601 TGTTGATAATCAGCTGCCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 119
1074168053_1074168056 13 Left 1074168053 10:110903556-110903578 CCAGCACTGGCTGGGCTACACTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1074168056 10:110903592-110903614 CTGCCCTGGGAGTCCAGAGTAGG 0: 1
1: 0
2: 2
3: 35
4: 326
1074168053_1074168059 17 Left 1074168053 10:110903556-110903578 CCAGCACTGGCTGGGCTACACTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1074168059 10:110903596-110903618 CCTGGGAGTCCAGAGTAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 354
1074168053_1074168054 -1 Left 1074168053 10:110903556-110903578 CCAGCACTGGCTGGGCTACACTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1074168054 10:110903578-110903600 TTGTTGATAATCAGCTGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074168053 Original CRISPR AAGTGTAGCCCAGCCAGTGC TGG (reversed) Intronic
904375671 1:30080761-30080783 AAGTGTAGAACAGCCAGTGAGGG - Intergenic
906658186 1:47563920-47563942 AAGTGTTGCTCAGCCTGTGGGGG + Intergenic
908437006 1:64116850-64116872 AAGTGTAACACATTCAGTGCAGG - Intronic
912401342 1:109396455-109396477 AAAGGTAGCCAAGCTAGTGCTGG - Intronic
912559522 1:110539914-110539936 AAGTGGGGCACTGCCAGTGCCGG - Intergenic
914705979 1:150170247-150170269 AAGTGCAGCCCAGCCTGTGAAGG + Intergenic
915513695 1:156400809-156400831 AAGGATAGCCCAGCCGGTGCCGG + Intergenic
916066025 1:161136361-161136383 AAGTCAACACCAGCCAGTGCTGG + Intergenic
916571082 1:166028362-166028384 AAGTGGAGAACAGCCAGAGCTGG + Intergenic
920186068 1:204160239-204160261 GGGTGTAGCCCAGTCAGAGCTGG + Intronic
1066433230 10:35372470-35372492 AAGTGTGGCTCAGCCAGCTCTGG + Intronic
1067661598 10:48240280-48240302 ATGTGTAGCCCATACAGGGCAGG + Intronic
1069606522 10:69742224-69742246 CAGTGGAGCCTAGCCAGTGGAGG - Intergenic
1072621290 10:97081219-97081241 AAGTATAACCCAGGCTGTGCTGG + Intronic
1072744440 10:97929952-97929974 AAGAGGAGCCCAGGCTGTGCTGG + Intronic
1073589474 10:104742744-104742766 AAGTGTAGCACAGTAAGCGCAGG + Intronic
1074168053 10:110903556-110903578 AAGTGTAGCCCAGCCAGTGCTGG - Intronic
1074445491 10:113518010-113518032 AACAGCAGCCCAGCCAGAGCAGG - Intergenic
1077283066 11:1754216-1754238 GAGTGCAGCCCAGCCAGGGGAGG - Intronic
1078337387 11:10474843-10474865 AGCTGTAGCCCAGCAAATGCTGG + Intronic
1084288615 11:68147458-68147480 AAGTGTGGCCCAACCATTCCAGG - Intergenic
1090205000 11:124879220-124879242 CAGTGTATCCCAGCCCATGCTGG + Exonic
1092422259 12:8341595-8341617 AGCTGCAGCCCAGGCAGTGCGGG - Intergenic
1094285184 12:28784516-28784538 AAGTGCAGCTCATCCACTGCTGG + Intergenic
1096513110 12:52142767-52142789 AAGCAGAGCACAGCCAGTGCAGG + Intergenic
1103605380 12:122082088-122082110 AGGTGAAGCCCTGCCAGTTCAGG - Intronic
1105407516 13:20144418-20144440 GAGTGGAGCCCAACCAGTGTGGG + Intronic
1113248817 13:108428747-108428769 AAAGGTAGCACAGCCAGTGAAGG + Intergenic
1115352854 14:32414263-32414285 AAGTGTATACCAGGGAGTGCTGG + Intronic
1115462623 14:33678506-33678528 AACTGAAGCACAGCCAGGGCAGG - Intronic
1117328257 14:54688473-54688495 AAGTCTGGCCAAGCCTGTGCTGG - Intronic
1118778859 14:68992733-68992755 AAGTGTAGCCCTGGCTGTGGTGG - Intergenic
1119038422 14:71250228-71250250 ACCTGTAGCCCAGTAAGTGCAGG - Intergenic
1120261622 14:82192235-82192257 AAGATTTGACCAGCCAGTGCTGG + Intergenic
1122663844 14:103315701-103315723 AATCCCAGCCCAGCCAGTGCAGG + Intergenic
1128674734 15:69600231-69600253 CAGTGAACCCCAGCCTGTGCTGG + Intergenic
1128824645 15:70702027-70702049 AAGTGTAGCACAGCATGTGAGGG - Intronic
1129499549 15:76023227-76023249 GAGTGTTGCCCAGAGAGTGCTGG + Intronic
1130078730 15:80712414-80712436 ATGTGTAGCCCAGCCAAGGAGGG + Intronic
1132547669 16:540725-540747 AGGCGGAGCCCAGCGAGTGCTGG - Intronic
1139674973 16:68517421-68517443 AAGGGTACCCCAGCCAGCTCTGG + Intergenic
1140887568 16:79258511-79258533 AAGAGAAGCCTAGCCACTGCAGG - Intergenic
1148851361 17:50557030-50557052 AAGTGGAGCCCAGCCTGGGGAGG + Intergenic
1149864007 17:60140248-60140270 AAGTGAATTCCTGCCAGTGCCGG - Intergenic
1155038334 18:22043990-22044012 AGGTTTATCTCAGCCAGTGCAGG - Intergenic
1155366824 18:25057204-25057226 AAGCCTAGCCCAGCCTGTGGGGG + Intergenic
1158299032 18:56031917-56031939 AAAGGTAGACCAGCCTGTGCAGG - Intergenic
1163863641 19:19755282-19755304 GAGTATAGCCCAGTCAGTGGCGG - Intergenic
1168076048 19:53981539-53981561 GAGTTTAGACCAGCCAGGGCTGG + Intronic
932700288 2:73986712-73986734 CAGGGTAGCCCAGCAAGGGCCGG - Intronic
936010033 2:108919728-108919750 AACTGTAGCCGGGCCAGAGCCGG + Intronic
937056777 2:118944139-118944161 AAATGTAACTAAGCCAGTGCAGG + Intronic
937380103 2:121368610-121368632 CAGTGTAGCCCAGCAGGTGTGGG + Intronic
940344268 2:152613044-152613066 AAGGGCAGCCCAGCCAGTCTAGG - Intronic
943892445 2:193307447-193307469 AAGTCTAGCACAGGCTGTGCAGG - Intergenic
943892540 2:193308851-193308873 AAGTCTAGCACAGGCTGTGCAGG - Intergenic
1170900487 20:20457805-20457827 ATGGGCAGCCCAGGCAGTGCTGG + Intronic
1173684052 20:44910287-44910309 AGGCGTAGCCCAGCGAGCGCCGG - Exonic
1174057784 20:47810333-47810355 GAGAGTAGCCCAGCCTCTGCCGG + Intergenic
1177359985 21:20055804-20055826 AACTCTAGACCAGCCACTGCTGG + Intergenic
1181959934 22:26615859-26615881 AAGTGTGGCCCAGCCAATCTGGG - Intronic
1182487483 22:30648033-30648055 AATGGTAGCCCAGCCAGTGGAGG - Intronic
1184669832 22:46006819-46006841 AATTGAGGCCCAGCCAGGGCAGG + Intergenic
954752411 3:52821136-52821158 AAGAGGGGCCCAGCCAGGGCAGG + Intronic
958582860 3:96049520-96049542 AAGACCAGCCCAGCCAATGCGGG + Intergenic
962044679 3:131743252-131743274 AACTGTAGACCAGCCTGTGAAGG + Intronic
963041586 3:141074155-141074177 GACTGAAGCCAAGCCAGTGCTGG - Intronic
963754402 3:149218995-149219017 ATGTTTAGCCCAGTCAGTGAAGG - Intronic
967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG + Intergenic
968683694 4:1940812-1940834 GAGTGTAGGCCTTCCAGTGCAGG + Intronic
970708487 4:18833929-18833951 AAGTGAAGGGGAGCCAGTGCAGG + Intergenic
972045496 4:34660659-34660681 AATAGTAGCCCACCCAGGGCTGG - Intergenic
972344649 4:38182743-38182765 CAGTGCAGACCAGCCCGTGCTGG + Intergenic
976302461 4:83528334-83528356 AAGTGTAGCCCAGCTACTCCTGG + Intergenic
977204321 4:94152778-94152800 CACTGTTGCTCAGCCAGTGCAGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
982871985 4:160591399-160591421 ATATGTAGCCCAGCCATTTCTGG + Intergenic
984059890 4:174978619-174978641 AGGTATTGCTCAGCCAGTGCTGG - Intergenic
987667873 5:20968371-20968393 AAGTTTACCCCAAGCAGTGCAGG - Intergenic
989197000 5:38725713-38725735 AAGAGTAGGACAGCCAGTTCTGG - Intergenic
992502184 5:77354191-77354213 AGGTGAAGCCCAGCCAGGCCTGG + Intronic
997715751 5:136041368-136041390 GAGTGTAGTCCAGCCACTGTGGG + Intronic
997749555 5:136331001-136331023 AAGTTTCCCCCAGCCACTGCTGG - Intronic
998531362 5:142888235-142888257 AAGGGCTGCACAGCCAGTGCTGG - Intronic
1003392934 6:5728956-5728978 AAGAGCACACCAGCCAGTGCTGG - Intronic
1008230901 6:48984090-48984112 AAGTGGAGCACAGCAACTGCTGG - Intergenic
1014905537 6:127022464-127022486 AAGTGTAGCGCAGCCAGTTCTGG + Intergenic
1018750811 6:166803417-166803439 AACTGTATTCCAGCCTGTGCTGG - Intronic
1024879961 7:54073998-54074020 ATGTGCAAACCAGCCAGTGCCGG - Intergenic
1026849739 7:73717323-73717345 CAGTCCAGCTCAGCCAGTGCTGG + Intronic
1028348977 7:89819684-89819706 GAGAGAAGCCCAGCCAGAGCTGG - Intergenic
1032951560 7:136920587-136920609 AAGTGTGGCCCAGCCTGTAAGGG - Intronic
1035640719 8:1183003-1183025 AAGTGTGTCACTGCCAGTGCGGG + Intergenic
1042776605 8:72439207-72439229 AAGTGCACACCAGCCATTGCTGG + Intergenic
1049744848 8:144258941-144258963 CGGTGGAGCCCAGCCAGTGCTGG - Intronic
1056839363 9:89986168-89986190 AAGTGAAGGCCAGCCATGGCCGG - Intergenic
1057304935 9:93906593-93906615 AAGGGGAGCCCAGCCCGTGGAGG + Intergenic
1057483152 9:95461570-95461592 AAGTGCAGCCAAGAGAGTGCAGG - Intronic
1061001922 9:127907440-127907462 AATTGAAGCCCAGCCAATGTGGG + Intergenic
1061193101 9:129093703-129093725 AGGTGTAGCCCAGACAATGGAGG - Intergenic
1186403269 X:9279073-9279095 AAGAATAGACAAGCCAGTGCAGG - Intergenic
1186513135 X:10146176-10146198 AAGTATATCCCAGCCAATGGTGG + Intergenic
1199219848 X:145305572-145305594 AAGTGGAGCTGAGCCAGTGCAGG + Intergenic