ID: 1074169409

View in Genome Browser
Species Human (GRCh38)
Location 10:110918697-110918719
Sequence CACGGGGGCGGGCCGCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074169398_1074169409 -3 Left 1074169398 10:110918677-110918699 CCTCACCCCACAGGGAGCCTCAC 0: 1
1: 1
2: 4
3: 33
4: 377
Right 1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG No data
1074169405_1074169409 -10 Left 1074169405 10:110918684-110918706 CCACAGGGAGCCTCACGGGGGCG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG No data
1074169402_1074169409 -8 Left 1074169402 10:110918682-110918704 CCCCACAGGGAGCCTCACGGGGG 0: 1
1: 2
2: 0
3: 15
4: 147
Right 1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG No data
1074169393_1074169409 30 Left 1074169393 10:110918644-110918666 CCTCTGGCTGGGTTAGGGCGGCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG No data
1074169395_1074169409 9 Left 1074169395 10:110918665-110918687 CCTGTAGAGCGGCCTCACCCCAC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG No data
1074169404_1074169409 -9 Left 1074169404 10:110918683-110918705 CCCACAGGGAGCCTCACGGGGGC 0: 1
1: 1
2: 0
3: 7
4: 124
Right 1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074169409 Original CRISPR CACGGGGGCGGGCCGCCGCC AGG Intronic
No off target data available for this crispr