ID: 1074172496

View in Genome Browser
Species Human (GRCh38)
Location 10:110956467-110956489
Sequence CTATATCCAAAGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074172496 Original CRISPR CTATATCCAAAGAAGCAGAG TGG (reversed) Intronic
901384205 1:8896497-8896519 AGGTATCCAAGGAAGCAGAGGGG - Intergenic
902435831 1:16397669-16397691 CTATAACCAAAGGAGCTGGGGGG + Exonic
907713376 1:56905228-56905250 TGATATCCAAAGAGGCACAGAGG + Intronic
907891950 1:58645083-58645105 TGATATCCAAATAAGAAGAGTGG + Intergenic
908338394 1:63150621-63150643 ATTTACCCAGAGAAGCAGAGGGG - Intergenic
909198718 1:72661006-72661028 CAAAATCCAAGGAAGCTGAGAGG - Intergenic
909488633 1:76201839-76201861 CTATGTCCTTAGAAGCAGAGTGG + Intronic
910214350 1:84827988-84828010 CTAAACCAAAAGAAGAAGAGGGG + Intronic
915255080 1:154622118-154622140 CTATGTCCTGAAAAGCAGAGTGG + Intronic
918201151 1:182268354-182268376 ATATATACCAAGAAGCTGAGTGG + Intergenic
918576258 1:186064030-186064052 ATAAATTCAAATAAGCAGAGGGG + Intronic
920403064 1:205689211-205689233 ATAAATCCAAGGAAGCAGGGTGG + Intergenic
1063484036 10:6402531-6402553 GTGTACCCAAAGAAGCAAAGGGG + Intergenic
1063575498 10:7258335-7258357 TTATATCCAAATAAGCCGAAAGG - Intronic
1065419944 10:25531936-25531958 CTATTTCTAGAGGAGCAGAGTGG - Intronic
1067560519 10:47301420-47301442 CTGTGTCCAGGGAAGCAGAGTGG + Intronic
1071410945 10:85394765-85394787 AGAAATCCGAAGAAGCAGAGTGG - Intergenic
1072305906 10:94106988-94107010 ATATAACCAAGGAAGCAGAGGGG - Intronic
1073420977 10:103423437-103423459 TTAGATCCAAAAAAGCAAAGAGG - Intronic
1074172496 10:110956467-110956489 CTATATCCAAAGAAGCAGAGTGG - Intronic
1077765883 11:5160129-5160151 CTATATCCAAAAAAGTAGAAAGG - Intronic
1078107448 11:8367435-8367457 CAGTACCTAAAGAAGCAGAGAGG - Intergenic
1078811432 11:14770329-14770351 CAATCTCCAAAGAAGCTGACAGG + Intronic
1078922250 11:15841617-15841639 CAAAATCCAAATCAGCAGAGCGG - Intergenic
1079020152 11:16903611-16903633 TTATATGCCAAGAAGCACAGTGG - Intronic
1080202038 11:29683306-29683328 CAATATCCAAAGAAGATAAGAGG + Intergenic
1081197084 11:40174666-40174688 CTATAACCATAGCAGCAGTGTGG + Intronic
1082181028 11:49119845-49119867 CTTTATCCAAAGAAGGAAAGTGG - Intergenic
1086199791 11:84188081-84188103 CTCTATCCAAATATGCAAAGTGG + Intronic
1086684461 11:89715027-89715049 CTTTATCCAAAGAAGGAAAGTGG + Intronic
1090901895 11:131039279-131039301 ATATAACCAAAGCAGAAGAGCGG + Intergenic
1092539480 12:9412016-9412038 ATAAATACAAAGAAGGAGAGGGG + Intergenic
1094003596 12:25723469-25723491 CAACATCCCAAGAAGCTGAGTGG - Intergenic
1094033553 12:26041570-26041592 TGATACCTAAAGAAGCAGAGTGG + Intronic
1098489839 12:71062563-71062585 TTTTATGCAAAGAAGCAAAGAGG - Intronic
1099721750 12:86370975-86370997 CTATATGTATAGGAGCAGAGAGG + Intronic
1104204480 12:126625109-126625131 TTATAACCATAGAAGCAGGGCGG + Intergenic
1105435281 13:20372054-20372076 CAAAGTCCAAAGAAGCTGAGGGG + Intergenic
1106486305 13:30175765-30175787 CTATATCCAAAAAAGGACACAGG + Intergenic
1106869838 13:34007140-34007162 CTTTTTCCAAAGTAGCATAGAGG + Intergenic
1107000679 13:35541137-35541159 ATATATTGTAAGAAGCAGAGAGG - Intronic
1107078998 13:36354188-36354210 CTATAACAAAAGAAGCATAAAGG + Intronic
1107115828 13:36744188-36744210 CAAAATCCAAAGAAGCTGAGTGG + Intergenic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1107706575 13:43113234-43113256 ATATATTGAAAGGAGCAGAGAGG + Exonic
1108089815 13:46837249-46837271 CTATTTCCCCAGGAGCAGAGAGG - Intronic
1109183873 13:59246727-59246749 GTATAACCAAAAAAGCAGAGGGG + Intergenic
1109502149 13:63251964-63251986 TTATTTCCAAAGAGGGAGAGAGG - Intergenic
1110353132 13:74534782-74534804 CAATAACCAAAGAAGCAAAAAGG - Intergenic
1112074339 13:95893293-95893315 CTATAGACATAGAAGCAGAATGG + Intronic
1112422503 13:99265378-99265400 TTTTTTCCAAAGAAGCACAGCGG - Intronic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1118229484 14:63934545-63934567 CTATTTCCAAATAAGATGAGGGG - Intronic
1124713245 15:32031754-32031776 GAATATCCAAAGCAGCATAGAGG - Intronic
1125809538 15:42525799-42525821 CTATAAACAAAGAATCAGATTGG - Intronic
1126497109 15:49303781-49303803 CTAGAGCCAAAGAAGCAGCTGGG - Intronic
1127208491 15:56745801-56745823 CTATCTATAAAGAAGCAGAAGGG - Intronic
1127521933 15:59751651-59751673 CTATATTGAAATAAACAGAGAGG + Intergenic
1130449345 15:84035135-84035157 CTAAATACAAAGAATGAGAGGGG - Intronic
1133210383 16:4260344-4260366 CTTTATATTAAGAAGCAGAGAGG + Intronic
1133481065 16:6171173-6171195 ATATAGACAAAGAAGGAGAGAGG - Intronic
1133568957 16:7022819-7022841 TTATATCCAAGGAAGCTGAGGGG + Intronic
1135800025 16:25485112-25485134 AGGTATCCAAATAAGCAGAGAGG - Intergenic
1138480147 16:57297373-57297395 CTGCCTCCAGAGAAGCAGAGAGG + Intergenic
1138830734 16:60371752-60371774 CTATTTCCAATTAAGCAGTGGGG + Intergenic
1138942916 16:61811848-61811870 TCAAATCCAAAGAATCAGAGAGG + Intronic
1139122417 16:64036573-64036595 CTCTATCCAAAGTAGGAAAGTGG - Intergenic
1139381539 16:66535454-66535476 TTATATCCAAAGAAGATGACTGG + Intronic
1140080979 16:71747248-71747270 CTTTATTCAAAAAAGCAAAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1144929692 17:18849252-18849274 CTATATCGAAAGACACAGATTGG - Intronic
1147640457 17:41995048-41995070 CTCTATCAAAAGAGGCAGTGTGG - Intronic
1147744111 17:42684621-42684643 CTATGGAGAAAGAAGCAGAGGGG + Intronic
1148291448 17:46454520-46454542 TTATAGATAAAGAAGCAGAGAGG + Intergenic
1148313636 17:46672222-46672244 TTATAGATAAAGAAGCAGAGAGG + Intronic
1149420198 17:56503094-56503116 CTATATCCACAGAAAAGGAGCGG - Intronic
1149426342 17:56558098-56558120 CTTTACCCAAACACGCAGAGGGG - Intergenic
1149990425 17:61380153-61380175 CTAAATCCACGGAAGCTGAGAGG + Intronic
1150917519 17:69451706-69451728 CCCTATCCAGAGAGGCAGAGAGG + Intronic
1154157076 18:11952021-11952043 CCAAATCCAAGGAAGCTGAGAGG + Intergenic
1155470359 18:26185387-26185409 CAATATTCAAAGTTGCAGAGTGG - Intronic
1155524589 18:26703669-26703691 CTCCACCCTAAGAAGCAGAGTGG - Intergenic
1155747284 18:29373253-29373275 CTATATCCAAAGACACAAATGGG + Intergenic
1157387134 18:47266764-47266786 CTATATGCAAGGAAGAAGACAGG + Intergenic
925518713 2:4715780-4715802 CTATTTGAAAAGAAACAGAGAGG + Intergenic
925803374 2:7624714-7624736 CTTTAGACAGAGAAGCAGAGGGG - Intergenic
925855121 2:8121934-8121956 CTATGTCCAAAGAAGAGTAGAGG + Intergenic
925877426 2:8324879-8324901 ATACATGCAAAGAAGTAGAGAGG - Intergenic
928081136 2:28313333-28313355 CTATCTCCAAAGCAGCAGGGAGG + Intronic
928831357 2:35488920-35488942 CTAAATCTAAAGAAGAAGAAAGG + Intergenic
929373057 2:41250148-41250170 CCATACCAAAACAAGCAGAGTGG - Intergenic
930558170 2:52926561-52926583 CTTTATTCAATGAAGGAGAGAGG + Intergenic
931782252 2:65588816-65588838 CTATCTTCAAAGCAGCAGAGTGG + Intergenic
936061983 2:109300881-109300903 CTGCCTCCAAAGCAGCAGAGAGG - Intronic
937804557 2:126123779-126123801 CTATAACTATAGAAGTAGAGGGG - Intergenic
938123850 2:128656183-128656205 CTCTAGCCAAAGGACCAGAGAGG - Intergenic
939558149 2:143701872-143701894 CTACATTCAAAGAAACAGAAAGG + Intronic
939558273 2:143703142-143703164 CTACATTCAAAGAAGCAGAAAGG + Intronic
941546018 2:166852678-166852700 TTATATTCAAAGCAGCAGAGTGG + Intergenic
941730507 2:168912178-168912200 CTAGACCCAGAGAAGCAGGGAGG - Intronic
942718093 2:178917766-178917788 CAATGTCCAATGAATCAGAGAGG + Intronic
943885536 2:193212343-193212365 CTTTATCCAAAGAAGGGGAAAGG + Intergenic
944665042 2:201952714-201952736 ATACATACAAAAAAGCAGAGAGG + Intergenic
945904858 2:215580406-215580428 GTGTATTCAAAGAAACAGAGAGG - Intergenic
946864985 2:224034743-224034765 CTATATCCCAAACAGCAGTGGGG - Intronic
948871604 2:240802537-240802559 CTACATACAAAGACACAGAGAGG + Intronic
1170254899 20:14330331-14330353 ATATATACAAAGTATCAGAGTGG - Intronic
1172327292 20:34046243-34046265 TTATCTCCAAAGAAGCAATGTGG + Intronic
1172797667 20:37553339-37553361 CCATATCCAAAAAAGTAGAAAGG + Intergenic
1173274339 20:41566508-41566530 CCTTATCCACAGGAGCAGAGTGG - Intronic
1174911267 20:54610457-54610479 CTATGGCCAAGGCAGCAGAGTGG - Exonic
1177705988 21:24705462-24705484 CCTTATCCATGGAAGCAGAGTGG + Intergenic
1177795210 21:25769626-25769648 CAACATCTAAAGCAGCAGAGAGG - Exonic
1178757853 21:35369386-35369408 GTCTATCCAAGGAAGCAGAAGGG + Intronic
1179343811 21:40537535-40537557 CTATTTCCAAATAAGGACAGAGG - Intronic
1180591174 22:16938538-16938560 ATATGTCCCAAGTAGCAGAGTGG + Intergenic
1181550490 22:23636523-23636545 TTATACCCAGAGAAGGAGAGAGG + Intergenic
1181797788 22:25322169-25322191 TTATACCCAGAGAAGGAGAGAGG - Intergenic
1183116238 22:35694703-35694725 ATTTATCCAAATATGCAGAGGGG + Intergenic
1183117129 22:35700737-35700759 ATTTATCCAAATATGCAGAGGGG + Intergenic
1183300611 22:37057286-37057308 ACATACCCAAAGAAGAAGAGAGG - Intronic
1183738881 22:39659189-39659211 CTTTGTCCAGAGAAGCACAGTGG - Intronic
955204779 3:56885993-56886015 CTATATCCAAGGACCCAGAATGG - Intronic
955322216 3:57982529-57982551 CTTTGTCCAGGGAAGCAGAGGGG - Intergenic
955327166 3:58017830-58017852 CTATAAGCAAAGAAGCAGTTTGG + Intronic
955479994 3:59380150-59380172 CTATATCCAATGGAGGAGGGTGG + Intergenic
955524786 3:59808939-59808961 CTATATTTTAAAAAGCAGAGAGG + Intronic
956645542 3:71452178-71452200 TTGTTTCCAAAGATGCAGAGTGG - Intronic
957232739 3:77541120-77541142 TTATATCCAAAGAAAAAGAGTGG + Intronic
957377905 3:79382922-79382944 CTATCTCCTAAGAAACAGAAAGG + Intronic
959550054 3:107644029-107644051 CTATAGATAAAGTAGCAGAGGGG - Intronic
960643888 3:119856446-119856468 GTACATCCAAAGTAGCAGGGTGG + Intronic
960773468 3:121221327-121221349 GTATATACAAAAAAGCAGGGGGG + Intronic
961215044 3:125153018-125153040 CTGTCTCCAAAGAAGAGGAGTGG - Intronic
964193308 3:154031879-154031901 CCAGAACAAAAGAAGCAGAGGGG + Intergenic
966152700 3:176881959-176881981 GTGTATCCAAATAAGAAGAGAGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
969984051 4:11188678-11188700 CAATATCCAGAGAACCAGGGTGG - Intergenic
970173393 4:13311442-13311464 GGATATCCAAATAAGAAGAGAGG + Intergenic
970201563 4:13613423-13613445 CTATATCCTGAGAAACAGTGTGG - Intronic
970391646 4:15618015-15618037 CTAAATCCAAAGTAGCAGGAGGG + Intronic
971129639 4:23792502-23792524 CAACATTCAAAGCAGCAGAGAGG - Exonic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
973567780 4:52205718-52205740 CTATGTCCAGAGAAACGGAGTGG - Intergenic
973607189 4:52599609-52599631 CTATATGGAAAAAAGCAGAAAGG + Intronic
975162690 4:71141996-71142018 TTATATCCAAAGCATTAGAGTGG + Intergenic
975465583 4:74705444-74705466 CTTTATCCACAGGAGTAGAGTGG + Intergenic
975500721 4:75081340-75081362 CTTTATCCACAAGAGCAGAGTGG + Intergenic
975873472 4:78808010-78808032 CTATTCCCAAAGAAGAAGAAAGG - Intronic
979202527 4:117995608-117995630 GTCTCACCAAAGAAGCAGAGAGG - Intergenic
979791119 4:124782305-124782327 CTCTACCCAAAGGTGCAGAGGGG + Intergenic
979936617 4:126705650-126705672 TTATATACAAAGAAGTAGAAAGG - Intergenic
982352964 4:154436011-154436033 ATTTAGCAAAAGAAGCAGAGAGG - Intronic
982539362 4:156648668-156648690 CTATATACAACAAAGCAGATTGG + Intergenic
984016425 4:174432396-174432418 CAATGTCCAAGGAAGCTGAGAGG - Intergenic
988536091 5:32070515-32070537 CTATATGCCATGAAGCAGAAGGG - Intronic
989196291 5:38719764-38719786 TCATAGCCAAAGAAGCAGTGAGG - Intergenic
990354942 5:54957755-54957777 CTATATCCAATGGAGAAGAAGGG + Exonic
991961349 5:72047615-72047637 GAAGATCCAAAGAAGCAGATAGG - Intergenic
993230932 5:85235282-85235304 CTGTAACCAAAGAAACACAGTGG + Intergenic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
995053993 5:107738918-107738940 CTATATGCAGAGATGCTGAGTGG + Intergenic
995183448 5:109249569-109249591 CTATGCCCAAAGAAGAGGAGAGG + Intergenic
995310796 5:110708117-110708139 CTCTCTGCAAAAAAGCAGAGGGG + Intronic
995453816 5:112331513-112331535 CTATATACAAAGTATCAGTGAGG - Intronic
1000118045 5:158171575-158171597 CTACAGCTAAGGAAGCAGAGAGG - Intergenic
1001318220 5:170659564-170659586 CTCTATACAAAGAAGGAGAAAGG - Intronic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1003509981 6:6771519-6771541 CTATGTCCAGAGAAGCAAATGGG - Intergenic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1003916064 6:10787307-10787329 CTATTGCTAAAGAAGCAGTGTGG + Intronic
1007035181 6:38666723-38666745 CCAGATCCACAGAATCAGAGTGG + Intergenic
1007069136 6:39022418-39022440 CTATAACCAAAGGAGCTGGGGGG + Intronic
1007276673 6:40679276-40679298 CTATATGCAAAGAAAAAGAGAGG + Intergenic
1007325526 6:41056579-41056601 CTGCATCCAAAAAACCAGAGAGG + Intronic
1008516883 6:52326926-52326948 CAATATCCAAAGAGGGAAAGTGG + Intergenic
1012176753 6:96096376-96096398 CTATATTCAACATAGCAGAGTGG + Intronic
1013932790 6:115554867-115554889 GAATGTGCAAAGAAGCAGAGAGG - Intergenic
1014341094 6:120207911-120207933 ATATATCCAAATAGGAAGAGAGG + Intergenic
1015187927 6:130439798-130439820 TAATATCCATGGAAGCAGAGAGG + Intronic
1017255582 6:152329675-152329697 CTGTTTACAAATAAGCAGAGTGG + Intronic
1017401727 6:154072076-154072098 CTATTGCCAAAGAAGGAGAAGGG - Intronic
1020226079 7:6281181-6281203 CTAGATCCAAATAAACAGGGAGG + Intergenic
1022988580 7:35685157-35685179 CTTTAGCCCAAGAGGCAGAGAGG + Intronic
1023201987 7:37708081-37708103 CTATATCCAAAGCATCTGAGAGG - Intronic
1023302183 7:38784627-38784649 CTATATCGAAAGAAGGAGGGGGG + Intronic
1023387746 7:39677098-39677120 GTATGGCCACAGAAGCAGAGTGG + Intronic
1025033146 7:55572949-55572971 CCACATCCAAGGAAGCAGTGAGG - Intronic
1025709593 7:63895041-63895063 CAACATCTAAAGCAGCAGAGAGG - Intergenic
1025933629 7:66015999-66016021 CCATATGCAAAGACTCAGAGTGG + Intergenic
1025950229 7:66139684-66139706 CCATATGCAAAGACCCAGAGTGG - Intronic
1027248193 7:76381217-76381239 CTTTATCCAAAGAAGATAAGTGG + Intergenic
1027414358 7:77959206-77959228 CTATAATCTAAGAAGCAGAAGGG - Intergenic
1027877259 7:83787032-83787054 CCTTATCCACAGGAGCAGAGTGG - Intergenic
1028165458 7:87533527-87533549 CTAAATCAAATGAAGCCGAGGGG - Intronic
1028747360 7:94343022-94343044 CTACCTCCAAAGAAACAAAGAGG + Intergenic
1030613443 7:111713482-111713504 CTAAAGGCAGAGAAGCAGAGAGG - Intergenic
1032025200 7:128435996-128436018 TTATATAGAATGAAGCAGAGAGG + Intergenic
1032273640 7:130434812-130434834 CTATAGTCAAAGGAGAAGAGTGG + Intronic
1033766724 7:144501280-144501302 CTTTACCAAAAGAAGGAGAGAGG - Intronic
1034697485 7:153066695-153066717 CCATTTCCCACGAAGCAGAGAGG + Intergenic
1037330100 8:17735903-17735925 ATAAATGCAAAGCAGCAGAGAGG + Intronic
1037981326 8:23256572-23256594 CCTTATCCCAGGAAGCAGAGAGG + Exonic
1039242262 8:35569821-35569843 CTATCTGCAAAACAGCAGAGGGG + Intronic
1039283978 8:36019569-36019591 CTATTTCTAAAGAAGCCCAGTGG + Intergenic
1039761458 8:40581064-40581086 CTATTTCTAAATAAGTAGAGTGG - Intronic
1042814507 8:72863993-72864015 CTGTCTCCAAAGAAAAAGAGGGG + Intronic
1045156842 8:99485779-99485801 CTATGTTCAAAGAAGCATAAAGG + Intronic
1045454723 8:102366434-102366456 CTGTATCCAGAAAAGCAGAGGGG - Intronic
1046114619 8:109769801-109769823 CAATCTCCAAAGCAGCACAGAGG - Intergenic
1047798930 8:128288670-128288692 ATATATGCAAAGAAACAGAGGGG - Intergenic
1048506375 8:135025834-135025856 CCACACCCAAAGAAGCAAAGGGG - Intergenic
1050920074 9:11189123-11189145 CTAGATGGCAAGAAGCAGAGAGG - Intergenic
1051334628 9:16054890-16054912 ATATATCCAAACACGCAGGGCGG + Intronic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1052435784 9:28427060-28427082 TGATATCCAAAGCAGCTGAGAGG - Intronic
1059215573 9:112558493-112558515 AAATATTCAAAGAAGTAGAGAGG - Intronic
1059862494 9:118480316-118480338 CTATATCCAAAGAAAACCAGAGG + Intergenic
1061094659 9:128448690-128448712 CTATATCCAAATGAGCAGCTGGG - Intergenic
1061502495 9:131011966-131011988 CTAGAACCTTAGAAGCAGAGTGG + Intronic
1188211281 X:27428195-27428217 CAATGTCCACAGAAGCAGGGAGG + Intergenic
1188267732 X:28098155-28098177 CAATATCAAACGCAGCAGAGAGG - Intergenic
1188322292 X:28754847-28754869 CTACATCCAAAGAAACAAAGAGG - Intronic
1190278508 X:48914295-48914317 CTGTAGGCCAAGAAGCAGAGAGG + Intronic
1191224410 X:58027512-58027534 AGATATCCAAATAAGAAGAGAGG - Intergenic
1193227411 X:78999864-78999886 CTATATTCAAATAGGAAGAGAGG + Intergenic
1193557813 X:82977758-82977780 ATATATCCAAATAGGAAGAGAGG + Intergenic
1193607585 X:83587687-83587709 GCACATCCAAAGAAGAAGAGAGG + Intergenic
1193685829 X:84575716-84575738 GTATATTCAAAGAGGAAGAGAGG + Intergenic
1193784529 X:85743514-85743536 ATATATCCAAAGAGGAAGAGAGG + Intergenic
1195441513 X:104904107-104904129 CAATATACAAATAAGGAGAGAGG - Intronic
1198373180 X:136011659-136011681 CTATATCGAAAGCACCAGGGAGG - Intronic
1198880045 X:141270960-141270982 ATATACCCAAAGAAGCAAAGAGG - Intergenic
1200176472 X:154120563-154120585 CTATAACCACAGATGCAGACAGG - Intergenic
1202015829 Y:20405577-20405599 TTCTTTCCAAAGAAGCTGAGAGG + Intergenic