ID: 1074176971

View in Genome Browser
Species Human (GRCh38)
Location 10:111017004-111017026
Sequence GGTTTCCACTGATGTTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074176970_1074176971 -9 Left 1074176970 10:111016990-111017012 CCAGGTAAAGATCAGGTTTCCAC No data
Right 1074176971 10:111017004-111017026 GGTTTCCACTGATGTTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074176971 Original CRISPR GGTTTCCACTGATGTTTAAC AGG Intergenic
No off target data available for this crispr