ID: 1074180917

View in Genome Browser
Species Human (GRCh38)
Location 10:111062078-111062100
Sequence CACAAAAAGGAGAAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074180913_1074180917 23 Left 1074180913 10:111062032-111062054 CCATCATGAAAACATGGAAAAGT No data
Right 1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG No data
1074180912_1074180917 26 Left 1074180912 10:111062029-111062051 CCACCATCATGAAAACATGGAAA 0: 2
1: 5
2: 15
3: 48
4: 336
Right 1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074180917 Original CRISPR CACAAAAAGGAGAAAGAGAC AGG Intergenic
No off target data available for this crispr