ID: 1074182162

View in Genome Browser
Species Human (GRCh38)
Location 10:111075238-111075260
Sequence CCTTTCCAGTGTTAGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074182162_1074182166 -5 Left 1074182162 10:111075238-111075260 CCTCAGAACTAACACTGGAAAGG No data
Right 1074182166 10:111075256-111075278 AAAGGGAGTTTATACCATTAGGG No data
1074182162_1074182168 6 Left 1074182162 10:111075238-111075260 CCTCAGAACTAACACTGGAAAGG No data
Right 1074182168 10:111075267-111075289 ATACCATTAGGGCAAAGATTGGG No data
1074182162_1074182165 -6 Left 1074182162 10:111075238-111075260 CCTCAGAACTAACACTGGAAAGG No data
Right 1074182165 10:111075255-111075277 GAAAGGGAGTTTATACCATTAGG No data
1074182162_1074182167 5 Left 1074182162 10:111075238-111075260 CCTCAGAACTAACACTGGAAAGG No data
Right 1074182167 10:111075266-111075288 TATACCATTAGGGCAAAGATTGG No data
1074182162_1074182170 15 Left 1074182162 10:111075238-111075260 CCTCAGAACTAACACTGGAAAGG No data
Right 1074182170 10:111075276-111075298 GGGCAAAGATTGGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074182162 Original CRISPR CCTTTCCAGTGTTAGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr