ID: 1074195614

View in Genome Browser
Species Human (GRCh38)
Location 10:111182034-111182056
Sequence CTTCACATTCAAATTTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074195611_1074195614 -6 Left 1074195611 10:111182017-111182039 CCCACTCATTTGTTGCTCTTCAC No data
Right 1074195614 10:111182034-111182056 CTTCACATTCAAATTTTGGATGG No data
1074195612_1074195614 -7 Left 1074195612 10:111182018-111182040 CCACTCATTTGTTGCTCTTCACA No data
Right 1074195614 10:111182034-111182056 CTTCACATTCAAATTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074195614 Original CRISPR CTTCACATTCAAATTTTGGA TGG Intergenic
No off target data available for this crispr