ID: 1074199869

View in Genome Browser
Species Human (GRCh38)
Location 10:111225197-111225219
Sequence AGAAGGAATCTAGAGAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074199869_1074199875 8 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199875 10:111225228-111225250 TGCTATAGGGTTCCCAAAGTGGG No data
1074199869_1074199872 -5 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199872 10:111225215-111225237 CTTCTTTCCACAGTGCTATAGGG No data
1074199869_1074199881 21 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199881 10:111225241-111225263 CCAAAGTGGGGACAGTCGGAGGG No data
1074199869_1074199874 7 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199874 10:111225227-111225249 GTGCTATAGGGTTCCCAAAGTGG No data
1074199869_1074199883 27 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199883 10:111225247-111225269 TGGGGACAGTCGGAGGGGTGAGG No data
1074199869_1074199882 22 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199882 10:111225242-111225264 CAAAGTGGGGACAGTCGGAGGGG No data
1074199869_1074199877 17 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199877 10:111225237-111225259 GTTCCCAAAGTGGGGACAGTCGG No data
1074199869_1074199876 9 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG No data
1074199869_1074199871 -6 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199871 10:111225214-111225236 CCTTCTTTCCACAGTGCTATAGG No data
1074199869_1074199879 20 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199879 10:111225240-111225262 CCCAAAGTGGGGACAGTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074199869 Original CRISPR AGAAGGAATCTAGAGAACCT AGG (reversed) Intergenic
No off target data available for this crispr