ID: 1074199876

View in Genome Browser
Species Human (GRCh38)
Location 10:111225229-111225251
Sequence GCTATAGGGTTCCCAAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074199867_1074199876 15 Left 1074199867 10:111225191-111225213 CCCTGACCTAGGTTCTCTAGATT No data
Right 1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG No data
1074199869_1074199876 9 Left 1074199869 10:111225197-111225219 CCTAGGTTCTCTAGATTCCTTCT No data
Right 1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG No data
1074199870_1074199876 -8 Left 1074199870 10:111225214-111225236 CCTTCTTTCCACAGTGCTATAGG No data
Right 1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG No data
1074199868_1074199876 14 Left 1074199868 10:111225192-111225214 CCTGACCTAGGTTCTCTAGATTC No data
Right 1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074199876 Original CRISPR GCTATAGGGTTCCCAAAGTG GGG Intergenic
No off target data available for this crispr