ID: 1074200763

View in Genome Browser
Species Human (GRCh38)
Location 10:111233167-111233189
Sequence CAGAGGAACCAGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074200763_1074200766 14 Left 1074200763 10:111233167-111233189 CCATCTTCTCTCTGGTTCCTCTG No data
Right 1074200766 10:111233204-111233226 TAGTTCATTATATTTTGCCAGGG No data
1074200763_1074200765 13 Left 1074200763 10:111233167-111233189 CCATCTTCTCTCTGGTTCCTCTG No data
Right 1074200765 10:111233203-111233225 GTAGTTCATTATATTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074200763 Original CRISPR CAGAGGAACCAGAGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr