ID: 1074202579

View in Genome Browser
Species Human (GRCh38)
Location 10:111251981-111252003
Sequence CCAAAGGCAAAATGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074202574_1074202579 -6 Left 1074202574 10:111251964-111251986 CCAAAAAGCACATGCAACCAAAG No data
Right 1074202579 10:111251981-111252003 CCAAAGGCAAAATGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074202579 Original CRISPR CCAAAGGCAAAATGGACAAA GGG Intergenic
No off target data available for this crispr