ID: 1074210860

View in Genome Browser
Species Human (GRCh38)
Location 10:111333720-111333742
Sequence GTTCTTTTATTCACAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074210860_1074210862 22 Left 1074210860 10:111333720-111333742 CCTTTTTTTGTGAATAAAAGAAC No data
Right 1074210862 10:111333765-111333787 CAAGCATCTTACATCCACAGTGG No data
1074210860_1074210861 -6 Left 1074210860 10:111333720-111333742 CCTTTTTTTGTGAATAAAAGAAC No data
Right 1074210861 10:111333737-111333759 AAGAACATGACTAAGACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074210860 Original CRISPR GTTCTTTTATTCACAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr