ID: 1074210862

View in Genome Browser
Species Human (GRCh38)
Location 10:111333765-111333787
Sequence CAAGCATCTTACATCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074210857_1074210862 25 Left 1074210857 10:111333717-111333739 CCCCCTTTTTTTGTGAATAAAAG No data
Right 1074210862 10:111333765-111333787 CAAGCATCTTACATCCACAGTGG No data
1074210859_1074210862 23 Left 1074210859 10:111333719-111333741 CCCTTTTTTTGTGAATAAAAGAA No data
Right 1074210862 10:111333765-111333787 CAAGCATCTTACATCCACAGTGG No data
1074210860_1074210862 22 Left 1074210860 10:111333720-111333742 CCTTTTTTTGTGAATAAAAGAAC No data
Right 1074210862 10:111333765-111333787 CAAGCATCTTACATCCACAGTGG No data
1074210858_1074210862 24 Left 1074210858 10:111333718-111333740 CCCCTTTTTTTGTGAATAAAAGA No data
Right 1074210862 10:111333765-111333787 CAAGCATCTTACATCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074210862 Original CRISPR CAAGCATCTTACATCCACAG TGG Intergenic
No off target data available for this crispr