ID: 1074210894

View in Genome Browser
Species Human (GRCh38)
Location 10:111334012-111334034
Sequence TAGGATGGCCACTGTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074210884_1074210894 29 Left 1074210884 10:111333960-111333982 CCAAATGCTGTAGGTTAAAGCAG No data
Right 1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074210894 Original CRISPR TAGGATGGCCACTGTGGAGA TGG Intergenic
No off target data available for this crispr