ID: 1074214381

View in Genome Browser
Species Human (GRCh38)
Location 10:111370029-111370051
Sequence CTCTCTATGCTGGACATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074214381_1074214385 -7 Left 1074214381 10:111370029-111370051 CCAACCATGTCCAGCATAGAGAG No data
Right 1074214385 10:111370045-111370067 TAGAGAGAAAAAAGGAAAGTTGG No data
1074214381_1074214387 24 Left 1074214381 10:111370029-111370051 CCAACCATGTCCAGCATAGAGAG No data
Right 1074214387 10:111370076-111370098 GTTTCCTTTTCACTGGAAAGAGG No data
1074214381_1074214386 17 Left 1074214381 10:111370029-111370051 CCAACCATGTCCAGCATAGAGAG No data
Right 1074214386 10:111370069-111370091 ATTTTGTGTTTCCTTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074214381 Original CRISPR CTCTCTATGCTGGACATGGT TGG (reversed) Intergenic
No off target data available for this crispr