ID: 1074216591

View in Genome Browser
Species Human (GRCh38)
Location 10:111390778-111390800
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074216588_1074216591 19 Left 1074216588 10:111390736-111390758 CCTTTATAAACATGGTTTCAAAG No data
Right 1074216591 10:111390778-111390800 GTGTACTGGCCATGTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074216591 Original CRISPR GTGTACTGGCCATGTTACAT TGG Intergenic
No off target data available for this crispr