ID: 1074233234

View in Genome Browser
Species Human (GRCh38)
Location 10:111558651-111558673
Sequence GATACTTATTTTTAGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074233229_1074233234 30 Left 1074233229 10:111558598-111558620 CCGTAACTTGAAGAAACAACAGG No data
Right 1074233234 10:111558651-111558673 GATACTTATTTTTAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074233234 Original CRISPR GATACTTATTTTTAGCTGCT GGG Intergenic
No off target data available for this crispr