ID: 1074233573

View in Genome Browser
Species Human (GRCh38)
Location 10:111562091-111562113
Sequence AGCCTGCTTTTGCCCTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074233573_1074233584 -9 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233584 10:111562105-111562127 AAGCAGGCTGGGGAAGGGTGGGG No data
1074233573_1074233589 21 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data
1074233573_1074233583 -10 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233583 10:111562104-111562126 AAAGCAGGCTGGGGAAGGGTGGG No data
1074233573_1074233585 2 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233585 10:111562116-111562138 GGAAGGGTGGGGAGAAGACCTGG No data
1074233573_1074233587 14 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233587 10:111562128-111562150 AGAAGACCTGGAAAGGCAAATGG No data
1074233573_1074233586 7 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233586 10:111562121-111562143 GGTGGGGAGAAGACCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074233573 Original CRISPR AGCCTGCTTTTGCCCTGGGA GGG (reversed) Intergenic
No off target data available for this crispr