ID: 1074233574

View in Genome Browser
Species Human (GRCh38)
Location 10:111562092-111562114
Sequence CAGCCTGCTTTTGCCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074233574_1074233584 -10 Left 1074233574 10:111562092-111562114 CCTCCCAGGGCAAAAGCAGGCTG No data
Right 1074233584 10:111562105-111562127 AAGCAGGCTGGGGAAGGGTGGGG No data
1074233574_1074233586 6 Left 1074233574 10:111562092-111562114 CCTCCCAGGGCAAAAGCAGGCTG No data
Right 1074233586 10:111562121-111562143 GGTGGGGAGAAGACCTGGAAAGG No data
1074233574_1074233587 13 Left 1074233574 10:111562092-111562114 CCTCCCAGGGCAAAAGCAGGCTG No data
Right 1074233587 10:111562128-111562150 AGAAGACCTGGAAAGGCAAATGG No data
1074233574_1074233585 1 Left 1074233574 10:111562092-111562114 CCTCCCAGGGCAAAAGCAGGCTG No data
Right 1074233585 10:111562116-111562138 GGAAGGGTGGGGAGAAGACCTGG No data
1074233574_1074233589 20 Left 1074233574 10:111562092-111562114 CCTCCCAGGGCAAAAGCAGGCTG No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074233574 Original CRISPR CAGCCTGCTTTTGCCCTGGG AGG (reversed) Intergenic
No off target data available for this crispr