ID: 1074233579

View in Genome Browser
Species Human (GRCh38)
Location 10:111562096-111562118
Sequence TCCCCAGCCTGCTTTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074233579_1074233585 -3 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233585 10:111562116-111562138 GGAAGGGTGGGGAGAAGACCTGG No data
1074233579_1074233587 9 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233587 10:111562128-111562150 AGAAGACCTGGAAAGGCAAATGG No data
1074233579_1074233586 2 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233586 10:111562121-111562143 GGTGGGGAGAAGACCTGGAAAGG No data
1074233579_1074233590 27 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233590 10:111562146-111562168 AATGGAGAATGGCCCGCCCAAGG No data
1074233579_1074233589 16 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074233579 Original CRISPR TCCCCAGCCTGCTTTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr