ID: 1074233589

View in Genome Browser
Species Human (GRCh38)
Location 10:111562135-111562157
Sequence CTGGAAAGGCAAATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074233577_1074233589 17 Left 1074233577 10:111562095-111562117 CCCAGGGCAAAAGCAGGCTGGGG No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data
1074233579_1074233589 16 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data
1074233574_1074233589 20 Left 1074233574 10:111562092-111562114 CCTCCCAGGGCAAAAGCAGGCTG No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data
1074233573_1074233589 21 Left 1074233573 10:111562091-111562113 CCCTCCCAGGGCAAAAGCAGGCT No data
Right 1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074233589 Original CRISPR CTGGAAAGGCAAATGGAGAA TGG Intergenic
No off target data available for this crispr