ID: 1074233590

View in Genome Browser
Species Human (GRCh38)
Location 10:111562146-111562168
Sequence AATGGAGAATGGCCCGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074233579_1074233590 27 Left 1074233579 10:111562096-111562118 CCAGGGCAAAAGCAGGCTGGGGA No data
Right 1074233590 10:111562146-111562168 AATGGAGAATGGCCCGCCCAAGG No data
1074233577_1074233590 28 Left 1074233577 10:111562095-111562117 CCCAGGGCAAAAGCAGGCTGGGG No data
Right 1074233590 10:111562146-111562168 AATGGAGAATGGCCCGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074233590 Original CRISPR AATGGAGAATGGCCCGCCCA AGG Intergenic
No off target data available for this crispr