ID: 1074238077

View in Genome Browser
Species Human (GRCh38)
Location 10:111606494-111606516
Sequence GGGAAGAATCTTTCTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074238071_1074238077 22 Left 1074238071 10:111606449-111606471 CCTTGTTTTTGAACTTGAACAGC No data
Right 1074238077 10:111606494-111606516 GGGAAGAATCTTTCTGAGAATGG No data
1074238073_1074238077 -3 Left 1074238073 10:111606474-111606496 CCACAATTTTACCCTTAGAAGGG No data
Right 1074238077 10:111606494-111606516 GGGAAGAATCTTTCTGAGAATGG No data
1074238070_1074238077 23 Left 1074238070 10:111606448-111606470 CCCTTGTTTTTGAACTTGAACAG No data
Right 1074238077 10:111606494-111606516 GGGAAGAATCTTTCTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074238077 Original CRISPR GGGAAGAATCTTTCTGAGAA TGG Intergenic
No off target data available for this crispr