ID: 1074248046

View in Genome Browser
Species Human (GRCh38)
Location 10:111714165-111714187
Sequence GCACTCTTGGGGGCTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074248046_1074248060 25 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248046_1074248053 -9 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248053 10:111714179-111714201 CAAGAGTGCAGAGAGATGACTGG No data
1074248046_1074248059 24 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248059 10:111714212-111714234 GCAGCTGCACCCAGGAGGGCAGG No data
1074248046_1074248054 -8 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248054 10:111714180-111714202 AAGAGTGCAGAGAGATGACTGGG No data
1074248046_1074248057 19 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248057 10:111714207-111714229 CATTTGCAGCTGCACCCAGGAGG No data
1074248046_1074248056 16 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248056 10:111714204-111714226 CCACATTTGCAGCTGCACCCAGG No data
1074248046_1074248058 20 Left 1074248046 10:111714165-111714187 CCTTCCCAAGCCCCCAAGAGTGC No data
Right 1074248058 10:111714208-111714230 ATTTGCAGCTGCACCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074248046 Original CRISPR GCACTCTTGGGGGCTTGGGA AGG (reversed) Intergenic