ID: 1074248050

View in Genome Browser
Species Human (GRCh38)
Location 10:111714176-111714198
Sequence GTCATCTCTCTGCACTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074248050_1074248058 9 Left 1074248050 10:111714176-111714198 CCCCAAGAGTGCAGAGAGATGAC No data
Right 1074248058 10:111714208-111714230 ATTTGCAGCTGCACCCAGGAGGG No data
1074248050_1074248059 13 Left 1074248050 10:111714176-111714198 CCCCAAGAGTGCAGAGAGATGAC No data
Right 1074248059 10:111714212-111714234 GCAGCTGCACCCAGGAGGGCAGG No data
1074248050_1074248060 14 Left 1074248050 10:111714176-111714198 CCCCAAGAGTGCAGAGAGATGAC No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248050_1074248056 5 Left 1074248050 10:111714176-111714198 CCCCAAGAGTGCAGAGAGATGAC No data
Right 1074248056 10:111714204-111714226 CCACATTTGCAGCTGCACCCAGG No data
1074248050_1074248057 8 Left 1074248050 10:111714176-111714198 CCCCAAGAGTGCAGAGAGATGAC No data
Right 1074248057 10:111714207-111714229 CATTTGCAGCTGCACCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074248050 Original CRISPR GTCATCTCTCTGCACTCTTG GGG (reversed) Intergenic