ID: 1074248051

View in Genome Browser
Species Human (GRCh38)
Location 10:111714177-111714199
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074248051_1074248057 7 Left 1074248051 10:111714177-111714199 CCCAAGAGTGCAGAGAGATGACT No data
Right 1074248057 10:111714207-111714229 CATTTGCAGCTGCACCCAGGAGG 0: 1
1: 2
2: 17
3: 55
4: 302
1074248051_1074248060 13 Left 1074248051 10:111714177-111714199 CCCAAGAGTGCAGAGAGATGACT No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248051_1074248059 12 Left 1074248051 10:111714177-111714199 CCCAAGAGTGCAGAGAGATGACT No data
Right 1074248059 10:111714212-111714234 GCAGCTGCACCCAGGAGGGCAGG No data
1074248051_1074248058 8 Left 1074248051 10:111714177-111714199 CCCAAGAGTGCAGAGAGATGACT No data
Right 1074248058 10:111714208-111714230 ATTTGCAGCTGCACCCAGGAGGG 0: 1
1: 3
2: 23
3: 74
4: 312
1074248051_1074248056 4 Left 1074248051 10:111714177-111714199 CCCAAGAGTGCAGAGAGATGACT No data
Right 1074248056 10:111714204-111714226 CCACATTTGCAGCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074248051 Original CRISPR AGTCATCTCTCTGCACTCTT GGG (reversed) Intergenic