ID: 1074248052

View in Genome Browser
Species Human (GRCh38)
Location 10:111714178-111714200
Sequence CAGTCATCTCTCTGCACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074248052_1074248059 11 Left 1074248052 10:111714178-111714200 CCAAGAGTGCAGAGAGATGACTG No data
Right 1074248059 10:111714212-111714234 GCAGCTGCACCCAGGAGGGCAGG No data
1074248052_1074248060 12 Left 1074248052 10:111714178-111714200 CCAAGAGTGCAGAGAGATGACTG No data
Right 1074248060 10:111714213-111714235 CAGCTGCACCCAGGAGGGCAGGG No data
1074248052_1074248058 7 Left 1074248052 10:111714178-111714200 CCAAGAGTGCAGAGAGATGACTG No data
Right 1074248058 10:111714208-111714230 ATTTGCAGCTGCACCCAGGAGGG No data
1074248052_1074248057 6 Left 1074248052 10:111714178-111714200 CCAAGAGTGCAGAGAGATGACTG No data
Right 1074248057 10:111714207-111714229 CATTTGCAGCTGCACCCAGGAGG No data
1074248052_1074248056 3 Left 1074248052 10:111714178-111714200 CCAAGAGTGCAGAGAGATGACTG No data
Right 1074248056 10:111714204-111714226 CCACATTTGCAGCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074248052 Original CRISPR CAGTCATCTCTCTGCACTCT TGG (reversed) Intergenic